ID: 1184181714

View in Genome Browser
Species Human (GRCh38)
Location 22:42832693-42832715
Sequence GCTAAATAGTAGGCCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184181708_1184181714 11 Left 1184181708 22:42832659-42832681 CCAAGACAGAGGTAGGCACACGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184181714 Original CRISPR GCTAAATAGTAGGCCCGGTG TGG Intronic
902405118 1:16178491-16178513 GGTAAAAAGAAGGCCAGGTGTGG - Intergenic
902899991 1:19508240-19508262 TTTAAAAAGTAGGCCAGGTGCGG + Intergenic
904100909 1:28026323-28026345 GAGAAATACTAGGCCAGGTGTGG + Intronic
904264114 1:29308045-29308067 GCTAAAAAATGGGCCAGGTGTGG - Intronic
904650619 1:32003246-32003268 ACTAAATAATAGGCTGGGTGCGG - Intergenic
905620214 1:39438790-39438812 AATAAATAATAGGCCGGGTGTGG + Intronic
907114225 1:51955033-51955055 GCTAAATAGTAAGGCCACTGAGG + Intronic
907156847 1:52342820-52342842 GCAAAATATAAGGCCGGGTGCGG - Intronic
908182800 1:61622805-61622827 GCTAATTTTTAGGCCGGGTGCGG - Intergenic
908750388 1:67416969-67416991 AATAAAAAGTAGGCCAGGTGTGG + Intronic
910243526 1:85114301-85114323 GATAAATTGTAGGCCAGGCGTGG - Intronic
911436102 1:97859918-97859940 TCTAAATATTAGGCTGGGTGTGG + Intronic
911436112 1:97860050-97860072 TCTAAATATTAGGCTGGGTGCGG + Intronic
911561253 1:99408764-99408786 GCTAAATAATAGTCCCTCTGAGG + Intergenic
912539473 1:110402534-110402556 GATAAAAAGTAGGCCCGGCATGG - Intronic
914374336 1:147060426-147060448 GCTGAAAAGAGGGCCCGGTGTGG - Intergenic
914820616 1:151099484-151099506 GCTAACTGATAGGCCAGGTGCGG - Intronic
916211102 1:162360681-162360703 GCTAAATAGAGGGCCTGGGGTGG - Intronic
919715422 1:200770702-200770724 TAGAAATAGTAGGCCAGGTGCGG - Intronic
1063794918 10:9502978-9503000 GTTAACAAGTAGGCCAGGTGTGG - Intergenic
1063960152 10:11300069-11300091 GCTAAAAATTAGGCCGGGTAGGG + Intronic
1064346931 10:14540897-14540919 GCTACAGTGTAGGCCCTGTGGGG - Intronic
1071544839 10:86521506-86521528 GGTAAATAGGAAGCCCGGTTGGG + Exonic
1072367418 10:94727322-94727344 GCTAAAGAAAAGGCCAGGTGTGG + Intronic
1073497263 10:103904323-103904345 TCTAAAAATTAGGCCGGGTGTGG + Intronic
1073627396 10:105113586-105113608 TCTAAATAGTAGGAGCTGTGTGG - Intronic
1078229340 11:9425448-9425470 GATAAAAAATAGGCCGGGTGTGG + Intronic
1080620598 11:33984159-33984181 ACTAAAAATTAGGCCAGGTGTGG - Intergenic
1080830156 11:35885590-35885612 GCCAATTAGGAGGCCAGGTGTGG + Intergenic
1084114700 11:67035288-67035310 GTTAAAAAGCAGGCCAGGTGTGG - Intronic
1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG + Intronic
1088031072 11:105251290-105251312 GCTAAATATTTGGCCAGATGTGG - Intergenic
1088670136 11:112132584-112132606 GCTAGCTAGCAGGCCAGGTGCGG - Intronic
1093215174 12:16353321-16353343 TCGAAACAGTAGGCCTGGTGTGG - Intronic
1094693085 12:32788763-32788785 GTTAACAAGTAGGCCGGGTGTGG + Intergenic
1097866695 12:64565069-64565091 CCCAAAAAGTAGGCCAGGTGTGG - Intergenic
1099614526 12:84917596-84917618 AATAAATATTAGGCCGGGTGCGG - Intergenic
1102564761 12:113789030-113789052 AATAAATACAAGGCCCGGTGTGG + Intergenic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1103788489 12:123451747-123451769 GATAAATATTAGGCCAGGCGCGG + Intergenic
1106311997 13:28562879-28562901 GAAACCTAGTAGGCCCGGTGGGG + Intergenic
1107386002 13:39910097-39910119 GCTAAAAAGTAAGCCCTATGAGG + Intergenic
1107585367 13:41841494-41841516 TATAAACAGTAGGCCGGGTGCGG + Intronic
1109631568 13:65055796-65055818 TCTAAAAAATAGGCCAGGTGCGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114520221 14:23329354-23329376 ACTAAATGGCAGGCCCTGTGAGG - Intergenic
1115277741 14:31626428-31626450 GCTAAACAGTGGGCCAGGTGCGG - Intronic
1116003891 14:39272061-39272083 ACTAATTAGGAGGCCGGGTGCGG + Intronic
1116794584 14:49376052-49376074 GTAAAATAGTTGGCCGGGTGCGG + Intergenic
1120029344 14:79622884-79622906 ACTAAGTAATAGGCCGGGTGCGG - Intronic
1124473665 15:30011629-30011651 GTTAAAAAGATGGCCCGGTGTGG + Intergenic
1126601123 15:50428405-50428427 ACTAAATTGTAGGCCCGGCGTGG - Intronic
1127251340 15:57241380-57241402 GATCAATAATAGGCCGGGTGCGG - Intronic
1128987704 15:72233159-72233181 GGTGCATAGTAGGCCGGGTGCGG + Intergenic
1129140791 15:73596242-73596264 ACTAATTAGCAGGCCCAGTGAGG + Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1133210962 16:4263316-4263338 TCTGACTAGCAGGCCCGGTGGGG + Intronic
1134089111 16:11381389-11381411 GCTCAAAAGTAGGGCAGGTGTGG - Intronic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1136252983 16:29018823-29018845 AATAAATCGTAGGCCAGGTGAGG - Intergenic
1139069149 16:63358954-63358976 GTTAAATATCAGGCCAGGTGCGG + Intergenic
1140363580 16:74364759-74364781 GGGAAATAATAGGCCGGGTGTGG - Intergenic
1141403892 16:83774662-83774684 AATAAATGGTAGGCCGGGTGTGG - Intronic
1142390366 16:89795891-89795913 GCTGAAAGGTAGGCCCAGTGTGG - Exonic
1145042360 17:19586306-19586328 GTTAAATTGTGGGCCAGGTGCGG - Intergenic
1146189736 17:30754197-30754219 GCAAAAAATTAGGCCAGGTGCGG + Intergenic
1151226239 17:72650368-72650390 GCTAAATACTAAGCCCCCTGAGG - Intronic
1154509580 18:15082291-15082313 CCTAAATATTTGGCCAGGTGTGG + Intergenic
1154948760 18:21187437-21187459 GCCAGCTAGTAGGCCAGGTGTGG - Intergenic
1157019788 18:43766705-43766727 ATTAAAAAGTAGGCCAGGTGTGG - Intergenic
1158488943 18:57892978-57893000 GCCAAATAGTAGGCCGGGCATGG - Intergenic
1161557129 19:4950182-4950204 AATAAATAGTAGGCTGGGTGTGG + Intronic
1161944894 19:7429310-7429332 GTTAAACAGAAGGCCAGGTGTGG + Intronic
1163707986 19:18827666-18827688 GAAAAATAGGAGGCCAGGTGCGG - Intergenic
1163749330 19:19066145-19066167 ACTATATAATAGGCCGGGTGTGG - Intronic
1164230089 19:23279598-23279620 GAAAAAAAGTAGGCCAGGTGTGG - Intergenic
1168324352 19:55530424-55530446 GGTGAATAGTTGGCCCTGTGAGG + Intronic
926453234 2:13033302-13033324 TATAAAAAGTTGGCCCGGTGTGG + Intergenic
929507323 2:42538415-42538437 GATAAATGTTAGGCCGGGTGCGG + Intronic
929739137 2:44584762-44584784 AAAAAATAGTAGGCCGGGTGCGG + Intronic
930474487 2:51864002-51864024 AGAAAATAGTAGGCCAGGTGCGG + Intergenic
933729176 2:85444523-85444545 GCTAAGTAGAAGGGCTGGTGGGG - Intergenic
940294723 2:152110592-152110614 ACTAAATAGCAGGCACCGTGAGG + Intergenic
942158325 2:173155385-173155407 GCTAGATAGTAGGCTCCATGAGG + Intronic
944711785 2:202341222-202341244 AATAAATAATAGGCCAGGTGTGG + Intergenic
1169097033 20:2910893-2910915 AATAAAAAGTAGGCCGGGTGCGG - Intronic
1173530374 20:43764953-43764975 GCTTAAAATTAGGCCGGGTGTGG + Intergenic
1176157816 20:63631139-63631161 GCTAAAAAGTTAGCCAGGTGTGG + Intergenic
1176788495 21:13289492-13289514 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1177329918 21:19645403-19645425 GCTAAATTGTCAGCCCAGTGAGG - Intergenic
1177494735 21:21873808-21873830 ACCAAATAGTAGGCCTGGTGCGG + Intergenic
1177987645 21:27997694-27997716 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1178330084 21:31682132-31682154 CCTAAAAAGTAGGCCAGGTGCGG + Intronic
1179020404 21:37635506-37635528 ACAAAATAATAGGCCAGGTGCGG - Intronic
1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG + Intronic
1184194105 22:42915156-42915178 CTTAAATCTTAGGCCCGGTGTGG - Intronic
1184307150 22:43612599-43612621 ACTAAAAAGTCGGCCAGGTGTGG + Intronic
954946727 3:54431896-54431918 GCTATAAAGTCGGCCAGGTGTGG - Intronic
955282036 3:57602859-57602881 GCTAAATGGTAGGCCGGACGTGG - Intergenic
955763255 3:62312837-62312859 GCTAAATCCCAGGCCGGGTGCGG + Intergenic
956443958 3:69307627-69307649 AAGAAATAGTAGGCCGGGTGTGG - Intronic
959568033 3:107852719-107852741 ACTAAATGGTAGGACAGGTGAGG + Intergenic
961099876 3:124189647-124189669 ACAAAATATTAGGCCAGGTGCGG + Intronic
965556731 3:170026136-170026158 CCTAGATAATAGGCCAGGTGTGG - Intergenic
965594999 3:170401782-170401804 ACTAAATAATAGGCCGGGCGCGG + Intergenic
966608911 3:181849069-181849091 GCTGAATATCAGGCCAGGTGTGG + Intergenic
966814103 3:183875122-183875144 GAAAAATAGTAGGCTGGGTGTGG + Intronic
967031374 3:185610450-185610472 GCTAGATAGTAGGCCGGGTGCGG - Intronic
967032418 3:185620355-185620377 ACTAAAAAGGAGGCCAGGTGCGG - Intronic
968251744 3:197223002-197223024 TCAAAATAGTAGGCACAGTGAGG - Intronic
970457023 4:16234565-16234587 GCTAAATAGTAGGCCATAAGTGG + Intergenic
971096323 4:23408835-23408857 GCTTAAGAGTAGACCTGGTGAGG - Intergenic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
974388069 4:61228980-61229002 GATAAATAAGAGGCCAGGTGTGG - Intronic
975875766 4:78835333-78835355 GTCAAATAGTTGGCCTGGTGCGG + Intronic
980883912 4:138741350-138741372 ACTAAATAGTAGAGGCGGTGGGG + Intergenic
983330894 4:166327356-166327378 AATAAATATTAGGCCGGGTGTGG - Intergenic
983530421 4:168804646-168804668 ACTTAATAGTAGGTCAGGTGTGG - Intronic
984120350 4:175734581-175734603 GCTATATAATAGGCTGGGTGTGG + Intronic
990388909 5:55298738-55298760 GCTAAATATTAGGCCGGGCGCGG + Intronic
994105067 5:95938431-95938453 TCTAAAAATTAGGCCCGGTATGG + Intronic
996091834 5:119358997-119359019 GTGAAATAGCAGGCCTGGTGAGG - Intronic
996809616 5:127501372-127501394 GCTAAATATATGGCCCAGTGCGG - Intergenic
997326032 5:133022084-133022106 GTTATAAAGTAGGCCGGGTGCGG - Intronic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
1000074814 5:157775146-157775168 AATAAATAATAGGCCGGGTGTGG + Intergenic
1000326131 5:160173819-160173841 GTTAAATCCTAGGCCAGGTGCGG + Intergenic
1002489620 5:179565467-179565489 CCTAGAAAGTAGGCCAGGTGTGG - Intronic
1003236183 6:4296994-4297016 GCTAAACCGTAGGCCCGAGGAGG - Intergenic
1006106965 6:31722564-31722586 TAGAAATAGTAGGCCGGGTGTGG + Intronic
1006654702 6:35580829-35580851 ACTAAAGAATAGGCCAGGTGTGG - Intronic
1007544459 6:42681916-42681938 TCTTAAAAGTAGGCCAGGTGTGG + Intronic
1010600438 6:77819019-77819041 GCTAAATATCAGGCTGGGTGTGG - Intronic
1011719078 6:90136535-90136557 GGTAAATAGTGGGCCAGGGGAGG - Intronic
1014480288 6:121927845-121927867 GCTAAAGAGCCGGCCGGGTGCGG + Intergenic
1018321623 6:162616259-162616281 GCTTGATAGTAAGCCCGCTGGGG + Intronic
1019260574 7:79706-79728 CCTAGATGGTAAGCCCGGTGAGG - Intergenic
1020065979 7:5189016-5189038 TATAAATAGAAGGCCAGGTGTGG - Intergenic
1024486207 7:49923555-49923577 GCAAAACAGTAGACACGGTGAGG - Intronic
1026020816 7:66704518-66704540 TTTAAATAGTCGGCCAGGTGCGG + Intronic
1026304036 7:69124606-69124628 TTTAAATATTAGGCCAGGTGCGG - Intergenic
1028859062 7:95627431-95627453 TCTAAAAAGTTGGCCGGGTGCGG + Intergenic
1028928529 7:96387317-96387339 TCTAAAAAATAGGGCCGGTGCGG + Intergenic
1028985767 7:97006970-97006992 GCTAGATAGGGGGCCCGGTCAGG - Intronic
1032833849 7:135655207-135655229 ACTAAATATTGGGCCAGGTGTGG - Intergenic
1047661086 8:127037728-127037750 GCTAAATAGTAGGGCGCATGTGG - Intergenic
1048566873 8:135609583-135609605 TCAAAAAGGTAGGCCCGGTGTGG - Intronic
1050331527 9:4550679-4550701 GTTAAAAAGTAGGGCAGGTGTGG - Intronic
1050612444 9:7367049-7367071 AGTAAATATTAGGCCAGGTGCGG + Intergenic
1050612906 9:7371804-7371826 GAAAAATAGTAGGCCGGGCGCGG + Intergenic
1052582578 9:30378063-30378085 CCTAAACATTAGGCCAGGTGTGG + Intergenic
1053391040 9:37736373-37736395 GGTAAATAGTGGGCCCGGTGTGG + Intronic
1056787308 9:89602576-89602598 GTTTAATAGTAGGCCGGGTGCGG + Intergenic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1060770600 9:126329071-126329093 ACTAAATAATAGGCCAGGCGTGG - Intronic
1062744112 9:138200684-138200706 CCTAGATGGTAAGCCCGGTGAGG + Intergenic
1185791779 X:2932690-2932712 AAGAAATAGTAGGCCAGGTGCGG - Intergenic
1188472178 X:30553382-30553404 AATAAATAGTAGGCCGGGTGCGG + Intergenic
1194801917 X:98284308-98284330 GCTAAAAAGTAAGCCCTCTGAGG - Intergenic
1195027630 X:100893976-100893998 TTTAAAAAGTAGGCCGGGTGCGG + Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic