ID: 1184186131

View in Genome Browser
Species Human (GRCh38)
Location 22:42866535-42866557
Sequence CTGTGAAAAGGGGTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888
Summary {0: 1, 1: 0, 2: 11, 3: 90, 4: 786}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184186122_1184186131 -2 Left 1184186122 22:42866514-42866536 CCACTCTGGGGAGACCTTGGACT 0: 1
1: 0
2: 2
3: 20
4: 154
Right 1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG 0: 1
1: 0
2: 11
3: 90
4: 786
1184186120_1184186131 1 Left 1184186120 22:42866511-42866533 CCACCACTCTGGGGAGACCTTGG 0: 1
1: 0
2: 1
3: 27
4: 285
Right 1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG 0: 1
1: 0
2: 11
3: 90
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184186131 Original CRISPR CTGTGAAAAGGGGTGGGGGA AGG Intronic
900014736 1:140149-140171 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900044603 1:495351-495373 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900045002 1:498758-498780 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066006 1:730257-730279 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066405 1:733666-733688 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900066801 1:737072-737094 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900067199 1:740488-740510 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
901530645 1:9850574-9850596 CTGTGAGGTGGGGTGGGGCAGGG + Exonic
901662820 1:10809444-10809466 CTGGGAAGAGGGGATGGGGAGGG + Intergenic
902227156 1:15003672-15003694 TTGGGAAAAGGGGTGGGGGACGG + Intronic
902805752 1:18860379-18860401 GTGTCAAAGAGGGTGGGGGAAGG + Intronic
903131282 1:21280896-21280918 CTGAGAAAAGGGGCCGGGCACGG + Intronic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903850904 1:26305492-26305514 CTTGGAAAAGGGGTGGGGGCTGG - Intronic
904389651 1:30173861-30173883 CTTTGGAAGGGGGTGGGGCAGGG - Intergenic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
904697338 1:32337689-32337711 CTGTGAAATGGGGCGGGGGTGGG - Intergenic
904819624 1:33233384-33233406 GTGTGAGAAGGGATGGGTGAGGG - Intergenic
904867789 1:33595473-33595495 GTGTGGAGTGGGGTGGGGGAAGG + Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
905699154 1:39999064-39999086 CCGTGGAAAGGGGAGGGGGAGGG - Intergenic
905746386 1:40422137-40422159 CTGTGGAAAGGGGAGAGCGAGGG - Exonic
905755465 1:40505621-40505643 ATGTGTGAAGGGGTTGGGGAGGG + Intergenic
905868108 1:41387334-41387356 CTTTGGAAAGGGGTGAGGAATGG - Intergenic
906211857 1:44016604-44016626 CAGTGGCAAGGGGTGGGGGAAGG - Intronic
906289626 1:44611163-44611185 CTGAGAAAATGGGGGTGGGATGG + Intronic
906298662 1:44665067-44665089 TGGTGAGAAGGGGTTGGGGAGGG - Intronic
906376326 1:45299629-45299651 CTGTGATCAGGGCTTGGGGAAGG - Intronic
906524636 1:46487123-46487145 CTGTGAAAGTGTGTGGGGGTAGG + Intergenic
906698847 1:47843068-47843090 TAGTGAAAGGGGGTGGAGGAGGG + Intronic
907317002 1:53578860-53578882 CTGTGAAAAGGGGTAGGTGGAGG - Intronic
907563477 1:55412580-55412602 CAGATAAAAAGGGTGGGGGATGG + Intergenic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
907949826 1:59171518-59171540 CCTTGAAAGGGGGTGGGGGTGGG + Intergenic
908237870 1:62164789-62164811 CTGTGAACAGGGGTTGGGGAAGG - Intergenic
908520423 1:64935992-64936014 TTGTGAAATGGGGAGGGGCAAGG - Intronic
908687462 1:66738030-66738052 CCAGAAAAAGGGGTGGGGGAGGG + Intronic
909643254 1:77889190-77889212 CTGGGGCAAGTGGTGGGGGACGG - Intronic
910164771 1:84314670-84314692 ATGTGGAAAGGGGTGGGAGGGGG + Intronic
910222171 1:84898606-84898628 CCATGGACAGGGGTGGGGGATGG + Intergenic
911450539 1:98054824-98054846 CTGTGAATTGGGGAGAGGGAGGG + Intergenic
911505778 1:98748823-98748845 ATGGGATATGGGGTGGGGGAAGG - Intronic
912260751 1:108109784-108109806 GTGGGAAATGGGGTGTGGGAAGG + Intergenic
913521833 1:119651851-119651873 CTGAGAAAAGGGGTGTGGGAAGG + Intergenic
914261078 1:145999682-145999704 TTGGGAAAAGGGGTGGGCCAAGG + Intergenic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
915512044 1:156391800-156391822 CCATGTAAAGGGGTGAGGGAAGG - Intergenic
915518601 1:156428521-156428543 GTGTGAAGAGGGCTGGGGTAGGG + Intronic
915899414 1:159835586-159835608 TTATGAATAGTGGTGGGGGAGGG - Exonic
916439770 1:164812161-164812183 CTTTGATTGGGGGTGGGGGAAGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917779863 1:178382568-178382590 CTGGTAAAAAGGGTGGGGGCAGG - Intronic
917874700 1:179275645-179275667 CTGGGAAAATGGGTGGGAAAGGG - Intergenic
918298085 1:183176722-183176744 CTTTTAAAAGGGGTGGGGCAGGG - Intergenic
918701305 1:187611826-187611848 CTGGGAAAGGTAGTGGGGGATGG + Intergenic
918849214 1:189663380-189663402 CGGGGAAAGGGGTTGGGGGAGGG - Intergenic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920160913 1:203997110-203997132 CTGGAAAAAGGGGAGGGGGGAGG - Intergenic
920347118 1:205313637-205313659 CTCTGAGAAGGGGTGGGGACTGG - Intronic
920525397 1:206662380-206662402 ATGTGAGACGGGGTGGAGGAGGG + Intronic
920719045 1:208369907-208369929 CCCTGAATAGGGGTTGGGGATGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921752389 1:218811055-218811077 ATGTGACAAGGGTTGGGGGAGGG - Intergenic
921786479 1:219236902-219236924 CTGTCAAGGGGTGTGGGGGAGGG - Intergenic
922093554 1:222421294-222421316 CTGTGAAAAGGGGCTGGAGGTGG - Intergenic
922342078 1:224665771-224665793 CTGGGAAAAAGGGAGGGGGGAGG - Intronic
922817728 1:228462765-228462787 CTGGGAAGAGTGGTGGGGAAAGG + Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
924344055 1:243057723-243057745 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
924374392 1:243390354-243390376 CTCTGATACTGGGTGGGGGAAGG - Intronic
924493064 1:244558892-244558914 CTGTGACTAGGAGTGGGGTAAGG - Intronic
924719767 1:246611182-246611204 CTGGGGAAAGGGGTGAGGTAAGG + Intronic
924941611 1:248816113-248816135 CAGAAAAAAGGGGTGTGGGATGG + Intronic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1063460969 10:6214895-6214917 CTGTGAGGATGGGTGGGGGGAGG - Intronic
1064066334 10:12185224-12185246 CTGGGGGAAGGGGTGGGGCATGG + Intronic
1064101675 10:12469311-12469333 ATATGAAAAGGGGAGGGGGGCGG - Intronic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1064784676 10:18880761-18880783 CTGTCAAAAGGGGAGGGAAAGGG - Intergenic
1065263444 10:23950696-23950718 CTATGAAAAGGGATGGGGTGGGG + Intronic
1065368700 10:24960042-24960064 ATGGGAAAGGGGGTGGGGGATGG - Intergenic
1067469074 10:46523306-46523328 CTGTTCACAGGGGTGGGGGTGGG - Intergenic
1068178778 10:53495264-53495286 CTGAGAAAAGCAATGGGGGAAGG - Intergenic
1068529953 10:58174611-58174633 CTGTGAGGAGTGGTGGGGGTGGG - Intergenic
1068748165 10:60559259-60559281 CTGGGGAAAGGGTTGGGGGGTGG - Intronic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070079925 10:73175946-73175968 CTGTGCAGTGGGGTGAGGGATGG + Intronic
1070084085 10:73218133-73218155 CAGTTAAAAGGAGTGGGGAATGG + Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072102426 10:92241306-92241328 CTGTGAGATAGGGTGGGGGTGGG + Intronic
1072758461 10:98036592-98036614 GTGTGAGGAGGGGTGGAGGAGGG + Intergenic
1073215848 10:101835671-101835693 GTGTGTAAAGGGGTGGGGAGAGG + Intronic
1073426801 10:103459847-103459869 CTGGGGAAAGGGGTGGGGTCTGG + Intergenic
1073466890 10:103699555-103699577 CTGAGCAAAGGGCTGGGCGAAGG + Intronic
1073709651 10:106022142-106022164 TAGAGAAAAGGGGTGGGGGTGGG + Intergenic
1073995130 10:109306974-109306996 CTGTAAAGAGTGGTGAGGGAAGG + Intergenic
1074003127 10:109392290-109392312 TTGAGGAGAGGGGTGGGGGACGG + Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1075111834 10:119594088-119594110 CTATGGAAAAGGGTGGGAGAAGG + Intronic
1075181619 10:120216027-120216049 CCGTGGAAAGGGGAGGGGGAGGG + Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075557655 10:123445014-123445036 CTGTGAAGTGAGGTTGGGGAAGG - Intergenic
1075863995 10:125702285-125702307 CTATGAAAAGAGGTTGGGGCTGG - Intergenic
1076167853 10:128296773-128296795 CTGCCAAAAGGGGTGGGGCCAGG + Intergenic
1076587707 10:131560706-131560728 CTGTGAGCTGGGGTGGGGGGGGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076970934 11:131826-131848 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1076971330 11:135249-135271 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1077066738 11:644436-644458 TTGAGAAGAGGGGTGTGGGAAGG - Exonic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077200111 11:1302533-1302555 CTGTGAAGGGTGGTGGGTGAGGG - Intronic
1077424652 11:2468944-2468966 CTGTGTCATGGGGTGGGTGAGGG + Intronic
1077534114 11:3111147-3111169 CTGTGGCAGGGGGTGGGGGTGGG - Intronic
1079031205 11:16987629-16987651 TTGTTTAAAGGGGTGGGGTAAGG - Intronic
1079262495 11:18897201-18897223 CTGTGGAAAGGGGTGGCTGTGGG - Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079690149 11:23406819-23406841 CAGTGAAAAGGGGGAGGGGGAGG - Intergenic
1080458358 11:32434607-32434629 CGGTCAAAAGGGGTAGGAGAGGG + Intronic
1081644227 11:44778586-44778608 CTGTAAAATGGGGAGAGGGATGG + Intronic
1081991113 11:47338168-47338190 GTGTACAAAGGGGTGGAGGAGGG - Intronic
1082090078 11:48081754-48081776 CTGTAAAATGGGTGGGGGGAAGG + Intronic
1082852246 11:57775728-57775750 CTTGGAATATGGGTGGGGGAGGG + Intronic
1082928829 11:58578956-58578978 CTGAAGGAAGGGGTGGGGGAGGG + Intergenic
1083234486 11:61342879-61342901 CTTTGGAAAGGGCTGAGGGAGGG + Intronic
1083275802 11:61596360-61596382 ATGAGAAAAGGGGTGGGGACGGG - Intergenic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083344190 11:61978112-61978134 CATGGACAAGGGGTGGGGGAGGG - Intergenic
1083487320 11:62991799-62991821 CTTAGAAAAGGGGTGGGGGCAGG + Intronic
1084096536 11:66915182-66915204 CTGTGAAATGGAGTGGAGGGCGG - Intronic
1084163786 11:67365631-67365653 CTGTGAAAAGGAGAGGGTGATGG + Intronic
1084608128 11:70184322-70184344 CTGTGAAAAGAGGAAGGGGCTGG + Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085289948 11:75390845-75390867 CAGTGAGAAGGCGTTGGGGAAGG - Intergenic
1085732761 11:79013440-79013462 CAGTGAAGGGGGTTGGGGGAAGG - Intronic
1086132973 11:83420217-83420239 CAGAGAGAAGGGGTGGGGGGGGG - Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087994407 11:104785782-104785804 TTGTGAAGATGGGTGGGGGGTGG + Intergenic
1088139226 11:106595558-106595580 TTTTGTAGAGGGGTGGGGGATGG + Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1088519576 11:110680509-110680531 CTATGAACAGGGGTGAGGAAGGG + Intronic
1088645155 11:111912012-111912034 CAGAGAACAGGGGTGGGGGTGGG - Intronic
1088913876 11:114212357-114212379 CTTTGAAAATGCCTGGGGGAGGG - Intronic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089865290 11:121626296-121626318 CTTGGAAGTGGGGTGGGGGAGGG + Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1089972244 11:122703460-122703482 TTTTGAAAAGCGGTGGTGGAGGG - Intronic
1090031337 11:123209184-123209206 GTGGGAGAAGGGTTGGGGGAGGG + Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090242576 11:125194459-125194481 CTGTGAAGCAGGGTGGGGGTGGG - Intronic
1090278735 11:125438326-125438348 CTGTGCAAAGGGGTCAGGGGAGG - Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090530258 11:127583506-127583528 TTGTGAAAAGGTGTGAGGGAAGG - Intergenic
1090727911 11:129544177-129544199 ATGTGAGAAGGGCTGGGGGCAGG - Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092127444 12:6084862-6084884 CTGTAATGATGGGTGGGGGAGGG + Intronic
1092285196 12:7124609-7124631 CTGGTAAATGGGGTGGGGGCTGG - Exonic
1092675707 12:10916571-10916593 CTATGAAAAGAGTTGGTGGAAGG + Intronic
1093151992 12:15632856-15632878 CTGTGGAAACCGGTGTGGGAAGG + Intronic
1093185653 12:16016300-16016322 CTCAGAAAAGGGGAGGGGAAGGG + Intronic
1095443561 12:42261727-42261749 CTTTGAGAAGGGGTGGGGGGAGG - Intronic
1096028685 12:48391511-48391533 CTGTCAACAGGGGTAGGGTAGGG - Intergenic
1096503390 12:52079087-52079109 CTGAGAAAAGGAGTGGGGGTGGG + Intergenic
1096569124 12:52509856-52509878 CTATCAAAGGGGTTGGGGGAAGG - Intergenic
1096616370 12:52835461-52835483 CTGAGAGAAGGGGGTGGGGAGGG - Intergenic
1096857567 12:54495685-54495707 ATCTGTAGAGGGGTGGGGGAAGG + Intergenic
1096865320 12:54559255-54559277 AAGAGAAAAGGGGTGGGGGTGGG - Intronic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097173413 12:57129421-57129443 CTGCAAAAGGGGGTGGGGGTGGG + Intronic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1097787419 12:63776886-63776908 CTGTGAAGAGTAGTGGGGGCAGG + Intergenic
1097952753 12:65450698-65450720 TTGAGTAAAAGGGTGGGGGAAGG - Intronic
1098130466 12:67344978-67345000 CTGTGGTGAGGGGAGGGGGAGGG - Intergenic
1099176488 12:79428603-79428625 GTGTGAGAAGAGGAGGGGGACGG + Intronic
1099662254 12:85578834-85578856 AGGTGAAATGGGCTGGGGGAGGG - Intergenic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1102011587 12:109622386-109622408 ATCTGAAAAGAGGTGGGGGAGGG - Intergenic
1102131374 12:110531801-110531823 CTGTAAACAGGTTTGGGGGAGGG - Exonic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102421545 12:112807311-112807333 CTGTGAAGAGGAGTGGAGGGTGG - Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102790442 12:115639856-115639878 CTGGGAGAGGCGGTGGGGGAAGG - Intergenic
1103241094 12:119413967-119413989 CTGGGAGAAGAGGTGAGGGAGGG - Intronic
1103366747 12:120389463-120389485 CTGTTAGAAGAGGAGGGGGAGGG + Intergenic
1104029046 12:125050758-125050780 CTATGACATGGGGTGGGGTAAGG + Intergenic
1104388820 12:128374461-128374483 CTCTGCAGAGGGGTGTGGGAAGG + Intronic
1104468918 12:129012948-129012970 CAGAGGTAAGGGGTGGGGGAAGG - Intergenic
1104617302 12:130281436-130281458 CTGTGAAAAGTGTTTGGGGGTGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1105639251 13:22245288-22245310 CTTTGACAAGGGCTGGGAGATGG - Intergenic
1105704572 13:22961140-22961162 CTGTGAAAAGGGGCTGGTGGGGG - Intergenic
1105761880 13:23522617-23522639 CTATGGAAAGGGTGGGGGGATGG + Intergenic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1105857529 13:24386192-24386214 CTGTGAAAAGGGGCCGGGTGGGG - Intergenic
1106047334 13:26155449-26155471 CAGTGAAGTGGGGTGGAGGATGG + Intronic
1106117478 13:26829903-26829925 ATGTGGAATTGGGTGGGGGATGG + Intergenic
1106350827 13:28929154-28929176 AGCTGAGAAGGGGTGGGGGAAGG + Intronic
1107123456 13:36819577-36819599 CTGTGCGAAGGGGCCGGGGATGG + Exonic
1107151565 13:37117460-37117482 TGTTGAAATGGGGTGGGGGAGGG + Intergenic
1107285623 13:38787482-38787504 CTGAGAAAAGGTGTGGGAGGAGG - Intronic
1107399258 13:40053140-40053162 CTGACAGAAGGGGTGGGGGTTGG - Intergenic
1107755293 13:43615020-43615042 CTGTGGAATTTGGTGGGGGATGG + Intronic
1108213465 13:48160992-48161014 CCTTTAAAAGGGGTGGAGGAGGG - Intergenic
1108404414 13:50085401-50085423 GAGTGGAAAGGGGTGGGGGAGGG - Intronic
1108481897 13:50881174-50881196 CTGGGGACAGGGGTGTGGGAGGG + Intergenic
1108685721 13:52817483-52817505 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1108688188 13:52838928-52838950 CTGGGAGAGGGGGTTGGGGAAGG + Intergenic
1108747224 13:53408548-53408570 CGGTGACAAAGGCTGGGGGAAGG + Intergenic
1109725705 13:66338636-66338658 GTGTGTAGAGGGGTGGGGGGTGG + Intronic
1110034726 13:70668874-70668896 ATGAGAATGGGGGTGGGGGAAGG - Intergenic
1110063610 13:71071938-71071960 ATGGGACTAGGGGTGGGGGATGG + Intergenic
1110407012 13:75162184-75162206 ATGCGGGAAGGGGTGGGGGATGG - Intergenic
1110484616 13:76023616-76023638 GTGAGAAAAGTGGTGGGGAAGGG + Intergenic
1111950938 13:94708418-94708440 TTGGGAAAAGGGGAGGGGGCGGG + Intergenic
1113611381 13:111647025-111647047 AGGTGGAAAGGGGTGGGGGAGGG - Intronic
1114471562 14:22966606-22966628 CTATGAAAGGGGGTGGAAGAAGG + Intronic
1115160042 14:30383673-30383695 ATGTGAATGAGGGTGGGGGATGG - Intergenic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1115387361 14:32813392-32813414 CTGGGAAAGGGGTTGGGGGGGGG - Intronic
1115499453 14:34036241-34036263 TGGTGAAAAGGGGAGAGGGAAGG - Intronic
1115513630 14:34163034-34163056 CTGTCAAAAGTGGTAGGGAAAGG + Intronic
1115513781 14:34164719-34164741 GTGTGAAACTGGGTGGGGAAAGG + Intronic
1115641238 14:35336920-35336942 CTGTGAGGAAGGGTGGAGGAGGG + Intergenic
1116492819 14:45526547-45526569 CTGGGAGAAGGGGTGAGTGAAGG + Intergenic
1117252708 14:53952584-53952606 GGGTGAAAAGGGGTGGGGGAGGG + Intronic
1117253114 14:53954548-53954570 CGGAGGAAGGGGGTGGGGGAAGG - Intronic
1117646836 14:57862069-57862091 CTTTGGAAAGGGGTGGGGGGTGG - Intronic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119643632 14:76332014-76332036 CTGTAAATTGGGGTTGGGGAGGG - Intronic
1119705308 14:76779444-76779466 CTGTGATGGGGGGTGGGGGTGGG + Exonic
1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG + Intergenic
1120736967 14:88064274-88064296 CTGAGAAATGGGGTGGGGAGAGG + Intergenic
1120795235 14:88625126-88625148 TTCTGAAAAGGAGTGGGGGAGGG + Exonic
1121520480 14:94582948-94582970 CAGTGAGAAAGGTTGGGGGAGGG + Intronic
1121701583 14:95958675-95958697 ATGTAAAAAGGCTTGGGGGAAGG - Intergenic
1121940534 14:98066257-98066279 CTGTGAGGTGGGGCGGGGGAAGG - Intergenic
1122031349 14:98914977-98914999 CTGTGAGACGGGGTGGGGTCTGG - Intergenic
1122497182 14:102166102-102166124 GTGAGAAGGGGGGTGGGGGATGG - Intronic
1123012756 14:105357261-105357283 GTGTGACCTGGGGTGGGGGAAGG - Intronic
1123627802 15:22239486-22239508 CTGTGAGCAGGGGTGGGGAGAGG - Intergenic
1125276335 15:37996067-37996089 CTGGGAAGTGGGGTGGGGAAGGG - Intergenic
1125335779 15:38624960-38624982 TTTAAAAAAGGGGTGGGGGAAGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126956660 15:53940166-53940188 ATGTAAAAAGGTTTGGGGGAAGG + Intergenic
1127271971 15:57409622-57409644 GTGTGAAAGGGGGAGGGAGAAGG + Intronic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1129252382 15:74316080-74316102 CAGTGATAAGGGGTGGGCAAGGG + Intronic
1129396307 15:75249859-75249881 CTGTGAACCGGGGTGAGGAAGGG + Intergenic
1129673053 15:77617579-77617601 GTGTGGGAAGGGGTGGGAGAAGG - Intronic
1129700186 15:77763337-77763359 AAGTGAGAAGGGGTTGGGGATGG + Intronic
1129775236 15:78232491-78232513 TGGTGAAAAGGGGTGGCAGAGGG - Intronic
1130230272 15:82091618-82091640 CCCCCAAAAGGGGTGGGGGAGGG + Intergenic
1130240159 15:82180664-82180686 ATGTTAAAAGGGGAGAGGGAAGG - Intronic
1131288124 15:91080287-91080309 CGGTGATAAGGAGTAGGGGAGGG + Intergenic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1131881935 15:96871169-96871191 CTGGGAGTTGGGGTGGGGGAGGG + Intergenic
1132252700 15:100346147-100346169 CAGTGAAAAGGGATAGGGGAGGG - Intergenic
1132347311 15:101116132-101116154 CTGAGAACAGTGGTGGGGGAAGG - Intergenic
1132686822 16:1165714-1165736 CTGTGAGCCGGGGTGGGGGCAGG - Intronic
1132716518 16:1292712-1292734 CTGGGAAAAGGAGAGAGGGAGGG - Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1134745862 16:16587765-16587787 CTGTCAGAATGGGTTGGGGAGGG - Intergenic
1134999617 16:18765977-18765999 CTGTCAGAATGGGTTGGGGAGGG + Intergenic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135121787 16:19772564-19772586 CTATGGACAGGGGTGAGGGAGGG + Intronic
1135923461 16:26671916-26671938 CTGAGAAAGGTGGTGGGGGGGGG - Intergenic
1136066678 16:27763701-27763723 CTGTTAAAAAGGGTGGGTGTGGG - Intronic
1136073867 16:27805002-27805024 CTGGGATTGGGGGTGGGGGAGGG + Intronic
1136912325 16:34154375-34154397 CGCCGACAAGGGGTGGGGGAAGG - Intergenic
1137357041 16:47777072-47777094 CTGAGAAAAGGAGAGAGGGAAGG + Intergenic
1137548629 16:49421485-49421507 CTGTGAACGTGGGTGGGGAAGGG + Intergenic
1137586289 16:49665670-49665692 CTGTGAGCTGGGGTGGGGGGCGG - Intronic
1137669352 16:50270465-50270487 CTGTGAAATGGGGTTGGTAAAGG + Intronic
1137752919 16:50880045-50880067 CTGTGACAAGGGGCGGGCGAGGG + Intergenic
1138405799 16:56792992-56793014 CTGTAAAATGGGGCAGGGGATGG + Intronic
1138515422 16:57533275-57533297 GTGTGGGAAGGGGTGGGGGTCGG + Intronic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1140134661 16:72195315-72195337 CTGTGAAAAGGAGAGGGGGAAGG - Intergenic
1140200106 16:72888134-72888156 CTGGAAAAGGGGGTGGGAGAGGG + Intronic
1140201918 16:72901907-72901929 CTTAAAAAGGGGGTGGGGGAAGG - Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1140808013 16:78551656-78551678 CTGAGAAACGGGGCGGGGGCAGG - Intronic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141538711 16:84700886-84700908 GTGAGAGAAGGGGTGGGAGAGGG - Intronic
1141613938 16:85199621-85199643 CTGTGAAAAGTGCTGCGGGCCGG + Intergenic
1141694696 16:85613922-85613944 CCGAGACAAGGGGTCGGGGAGGG - Intronic
1142229622 16:88893765-88893787 CTGAGAAAAGGGGTGAGGCCCGG - Intronic
1142448923 16:90162273-90162295 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1142449324 16:90165692-90165714 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1142457772 17:66189-66211 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1142458172 17:69609-69631 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1143186970 17:5015987-5016009 CTGTGAAAATGAGTTGGGCAGGG + Intronic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1143632291 17:8146202-8146224 CAGGGAAAAGGGGAAGGGGATGG + Intronic
1143895445 17:10132805-10132827 CTTTTAAAAAGGCTGGGGGAGGG + Intronic
1144110168 17:12022716-12022738 CTGTGAAGATGGGGGAGGGAAGG + Intronic
1144521599 17:15956274-15956296 TAGTGATAACGGGTGGGGGAGGG - Intronic
1144729774 17:17519658-17519680 CCTTGAAAAGGGGTGGATGACGG + Intronic
1145735845 17:27231176-27231198 TTATCAAAAGGGGTGGGGGAAGG + Intergenic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146430079 17:32784821-32784843 CTGTGGGGAGGGGTGGGGTATGG + Intronic
1146938453 17:36826923-36826945 CTGTGAAGAGGAGGGGAGGAAGG - Intergenic
1147159181 17:38560687-38560709 CTGTGGAATGGTTTGGGGGAGGG - Intronic
1147330871 17:39698707-39698729 CTGTAAAGAGGTGTGGGAGATGG + Intronic
1147747439 17:42703702-42703724 CTGGGAGGTGGGGTGGGGGATGG - Intronic
1147786537 17:42982275-42982297 TGGTGAAAAGGGATGGGGCATGG - Intronic
1148461217 17:47840092-47840114 CTGTGAACCAGGCTGGGGGAGGG + Intronic
1148618470 17:49016911-49016933 CTGAGAAAGGGGGCGGGGGCGGG - Intronic
1148657483 17:49298587-49298609 GTGTGAGAAGGGGTGGGGGATGG + Exonic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148767494 17:50047627-50047649 CTGTGATGAGGGGTGAGGGCTGG + Intergenic
1148812097 17:50299966-50299988 CAGGGAAAAGGGGTGGGTGATGG - Intergenic
1148822715 17:50369381-50369403 ATCGAAAAAGGGGTGGGGGAGGG + Intronic
1148836822 17:50469805-50469827 CTGTGAGGAGGGGTGCGGGAGGG + Intronic
1150204933 17:63396534-63396556 CTGTGAAGAGGGGTGTGGGGTGG + Intronic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151527481 17:74680939-74680961 ATGTGAACAGGGGTGGTGGTGGG - Intronic
1151875158 17:76863873-76863895 CAGTGAAAAGGGATGGGGTTTGG - Intergenic
1151945037 17:77314992-77315014 TTGTGAGAAGGGGTGGGGAAAGG + Intronic
1151971745 17:77460903-77460925 CACTTAAAAGGAGTGGGGGATGG - Intronic
1152181129 17:78822459-78822481 CTGGGAAGAGGGGTGGGGGTGGG + Intronic
1152430581 17:80246400-80246422 CTGGGGACAGGGGTGGGGGTAGG - Intronic
1152514953 17:80817633-80817655 CCGGGAGAAGGGGTGGGGGAGGG + Intronic
1152560104 17:81073656-81073678 CAGTGAAAAAGACTGGGGGAGGG - Intronic
1153701085 18:7693873-7693895 CTATGAACAGGAGTAGGGGAAGG + Intronic
1153895847 18:9558894-9558916 CTGTTGAAAGGGGTTGGGGGTGG + Intronic
1155180188 18:23338636-23338658 ATGTGAAAATGGCTGGGGGGTGG - Intronic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155536803 18:26827181-26827203 CTGTGAAAATGAGAGGGGGTGGG - Intergenic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156526754 18:37775189-37775211 CTCTGAGAAGGGGTGTGGCAGGG + Intergenic
1156600839 18:38604178-38604200 CTGTGTAAAGGGATGAGGGTGGG + Intergenic
1156682257 18:39605312-39605334 GTGGGAAAAGGAGTGGGGGCTGG - Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1158115783 18:53993704-53993726 CAGGAAAAAGGGGTGGGGCACGG - Intergenic
1159190806 18:65039713-65039735 GGGTGAAAAGGGATGGAGGAGGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159986634 18:74849515-74849537 GTGTGGTCAGGGGTGGGGGACGG + Intronic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160443999 18:78913367-78913389 CTGTGAGCAGGGGTGGGAGTGGG - Intergenic
1160496477 18:79378969-79378991 CTCTGAAAAGCTGCGGGGGAGGG - Intergenic
1160647885 19:202115-202137 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1160648283 19:205529-205551 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1160798410 19:956138-956160 ATGTGAATTTGGGTGGGGGATGG + Intronic
1160829788 19:1098388-1098410 CAGTGAAAAGAGGGGTGGGAGGG + Intergenic
1161026552 19:2039857-2039879 CTGGGAAACGGGGTGGGGGTAGG + Intronic
1161251706 19:3284425-3284447 CTAGGGAAAGGGGTAGGGGAGGG - Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1162145629 19:8610988-8611010 CGGGGAGAATGGGTGGGGGAGGG + Intergenic
1162352145 19:10157343-10157365 GTGTGAAAAGGGATGTGGGAAGG + Intronic
1162967808 19:14164265-14164287 CTGTGCACAGGGGTGGGGGTGGG + Intronic
1163454645 19:17399308-17399330 GTGTGAGTAGGGGTGGGGGTGGG + Intergenic
1163865377 19:19769482-19769504 CCGTGCAAAGGGGAGAGGGAGGG - Intergenic
1163978160 19:20872419-20872441 CTGTGAAAACGAGTGGCTGAAGG - Intergenic
1164596016 19:29530981-29531003 CTGGGAGAAGGGATTGGGGATGG + Intronic
1164805010 19:31109691-31109713 TTGAGATAAGAGGTGGGGGAAGG + Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165373345 19:35424276-35424298 CTGTGAGAGGGTGTGGGGCAAGG + Intergenic
1165926170 19:39327531-39327553 ACCTGAAAAGGGGTGGGGGGAGG + Intergenic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166220798 19:41363349-41363371 CTGCGTTAAGGGGTGGAGGAAGG + Intronic
1166382736 19:42363155-42363177 AGGTGACAAGGGGTGGGGCAGGG - Exonic
1166512332 19:43417448-43417470 ATGTGAAAATGGGGTGGGGAGGG - Intronic
1166667340 19:44688999-44689021 GAGAGAAATGGGGTGGGGGAGGG + Intergenic
1166881952 19:45935131-45935153 GTAGGGAAAGGGGTGGGGGAGGG + Exonic
1166959058 19:46487170-46487192 CTGAGATAGGGGTTGGGGGAGGG + Intronic
1167161995 19:47774077-47774099 GAGAGAAAAGGGGAGGGGGATGG + Intergenic
1167359622 19:49023317-49023339 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167361509 19:49032768-49032790 CTGCGGAATGGGGTGTGGGAGGG + Intronic
1167362145 19:49036017-49036039 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167363939 19:49044841-49044863 CTGCGGAATGGGGTGTGGGAGGG + Intronic
1167364559 19:49048086-49048108 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167365844 19:49054722-49054744 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167424470 19:49423051-49423073 CAGAGACTAGGGGTGGGGGAAGG - Intronic
1168547231 19:57263522-57263544 TTGATAAAGGGGGTGGGGGAAGG - Intergenic
925015572 2:521948-521970 CCGTGAAAAGGGGTGGGAAGTGG + Intergenic
925263395 2:2547308-2547330 CTGAGATAAGGGGTGGGCAAGGG + Intergenic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
926165860 2:10521932-10521954 CTGTGACTGGGTGTGGGGGAGGG + Intergenic
926704401 2:15826542-15826564 CTGGGAAAAGGGGAGGGGTGTGG - Intergenic
927699645 2:25259718-25259740 CCTGGAGAAGGGGTGGGGGAAGG - Intronic
927767286 2:25822447-25822469 TTGTGAACAGGGCAGGGGGACGG - Intronic
927846877 2:26476573-26476595 GTGAGGGAAGGGGTGGGGGAAGG - Intronic
927846901 2:26476621-26476643 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846920 2:26476657-26476679 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846927 2:26476669-26476691 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
927846946 2:26476705-26476727 GTGGGGGAAGGGGTGGGGGAAGG - Intronic
928466513 2:31527736-31527758 CTGTGAGGAGGGGTGGCAGAGGG - Intronic
929178685 2:39008945-39008967 CTCTTACAAGGGGTGGGGGTGGG + Intronic
929316623 2:40486871-40486893 CTCTACAAAGGGGTGGGGGGAGG - Intronic
929339823 2:40801705-40801727 CTGTGACTTGGGGTGGGGGGAGG - Intergenic
929456958 2:42072950-42072972 CTGGGCTCAGGGGTGGGGGAGGG - Intergenic
929965481 2:46531693-46531715 CTATAATTAGGGGTGGGGGAAGG - Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930095589 2:47563666-47563688 CTGTAATTAGGGGTGGGGGCTGG - Intronic
930619764 2:53631441-53631463 CGGTGAAAAGGTGAGAGGGAGGG + Intronic
930805987 2:55491184-55491206 GTGTGAATTGGGGTTGGGGATGG + Intergenic
930862783 2:56092262-56092284 CTGTGAAAAGGAATAGGGGCTGG + Intergenic
931591869 2:63893308-63893330 AAGTGAACTGGGGTGGGGGAAGG - Exonic
931874733 2:66499486-66499508 CTGTAAGAAGGTGTGGGGGAAGG - Intronic
932306208 2:70705697-70705719 CTGTGGGATGGGGTGTGGGAAGG - Intronic
932322832 2:70834591-70834613 ATGTGAAAGTGGGTGGGGCAAGG - Intronic
932420725 2:71599798-71599820 TGGTGAACAGGGGTGGGGGAAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934045677 2:88170868-88170890 TTGTGAGAAGGGGTGGGACAGGG - Intronic
934095174 2:88595134-88595156 GTGTGGAATGGGGTGGGGGTGGG + Intronic
934299728 2:91769766-91769788 CTGTGGATTGGGGTGGGGCAGGG + Intergenic
934574777 2:95392944-95392966 CTGGGGAAAGGGGTGAGGGATGG + Intergenic
934925402 2:98378834-98378856 ATGAGAAAATGGGAGGGGGAAGG - Intronic
935171836 2:100616190-100616212 ATCTGAAATGGGGTGGGGGTTGG - Intergenic
935224343 2:101040091-101040113 CTGTGAGATGGAGTGTGGGAGGG - Intronic
936517912 2:113193687-113193709 CTGTAACAAGGGGTGCGGGGAGG + Intronic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937265707 2:120613614-120613636 CTGGGAATCGGGGTGGGGGTGGG - Intergenic
937305171 2:120866590-120866612 CTGCTAATGGGGGTGGGGGATGG - Intronic
937391396 2:121490459-121490481 TTGTAAAAAGGGTTGGGGGTTGG + Intronic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
939354632 2:141085133-141085155 AAGAGAAATGGGGTGGGGGAAGG + Intronic
940210149 2:151248454-151248476 CTGTAAGAAGGGGAGGGGAAAGG + Exonic
940241094 2:151563905-151563927 CTGTATAAAGGGGCGTGGGAGGG - Exonic
940420735 2:153477574-153477596 GTGGGAGAAGGGGTGGGGGGAGG - Exonic
940693981 2:156956077-156956099 CTCTGCAGAGGGATGGGGGATGG + Intergenic
940962033 2:159797209-159797231 CTGGGGCAAGGGGTGGGGGGGGG + Intronic
941095540 2:161237302-161237324 CTGCTAAAAGTGGTGGGGGCGGG - Intergenic
941497015 2:166218252-166218274 ATGTAAAATGGGGTGGGGGGAGG + Intronic
941640897 2:167987234-167987256 CAGAGAAAAGGGGAAGGGGAAGG - Intronic
941822527 2:169856817-169856839 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
942023803 2:171893825-171893847 CAGTGAATTGCGGTGGGGGAGGG - Intronic
942044539 2:172092250-172092272 CTCTAAAAAGGGGTAGGGGTAGG + Intergenic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942205601 2:173617444-173617466 GTGTGAAAAGGAATGAGGGAGGG - Intergenic
942385956 2:175443116-175443138 TTCTGAAAAGGGCTGTGGGAGGG - Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
944425104 2:199572960-199572982 CAGTGAGCAGGGGTGGGGAATGG - Intergenic
944509597 2:200451618-200451640 ATGTGAAAAGGGGAGGGGAGGGG - Intronic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
945090540 2:206172584-206172606 CTGTGGAAAGGAGAGGGAGAGGG + Intergenic
945239766 2:207665738-207665760 GTGTGAAGAGGGGGAGGGGAAGG + Intergenic
945259718 2:207832302-207832324 AAGAGAAAAGGGTTGGGGGAGGG - Intronic
945688022 2:212996269-212996291 CTGTGCAGAGGGGTGGGGTGAGG + Intergenic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946149915 2:217757214-217757236 CTGTGCAAAAGGGTGGGAGTTGG + Intergenic
946609256 2:221440152-221440174 GGGAGGAAAGGGGTGGGGGAAGG + Intronic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
946740295 2:222794565-222794587 ATTTGACAGGGGGTGGGGGAAGG + Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
947501475 2:230674400-230674422 CAGAGAAAGGGGGTAGGGGAAGG + Intergenic
947898180 2:233694754-233694776 CTGTGAAAAGGCAAGGGTGAGGG + Intronic
948311979 2:236994127-236994149 GTCGGGAAAGGGGTGGGGGAGGG - Intergenic
948862614 2:240760249-240760271 CTGGGAGAGGTGGTGGGGGATGG - Intronic
1168821193 20:774838-774860 CTGAGATCAGGGGTGGGGCAGGG - Intergenic
1169171919 20:3471707-3471729 AGGTGAAAAGGTGTGGGGCAAGG + Intronic
1169189074 20:3645754-3645776 CTGTGAAGGGGAGTGGGGGTGGG - Intronic
1169415878 20:5415783-5415805 CTGAGAAAAAGGGTGGGGGGAGG + Intergenic
1169587083 20:7096995-7097017 CTTTGGAAATGGGTGTGGGAGGG + Intergenic
1169743121 20:8916621-8916643 CTGAGAAATGGGGTAGTGGATGG - Intronic
1169867673 20:10218421-10218443 CACTGAAAGGGGGTGGGGGTGGG + Intergenic
1170525257 20:17229410-17229432 CCATGAAAAGGTGTGGGGGAGGG - Intronic
1171131389 20:22656854-22656876 CTGTGAAGAGAGGTGGGGAAGGG + Intergenic
1171171289 20:23017647-23017669 CTGAGACATGGGGTGGGGGGAGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172038675 20:32028698-32028720 CTGTGCAAAAGGGAGGGGAAAGG + Intronic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172793665 20:37522950-37522972 CGGTGCAAAGGGGTTGGGAAGGG - Exonic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172890635 20:38261142-38261164 CTGTAAAATGGGGTGGGAGGAGG + Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173036184 20:39413363-39413385 ATGGAAAAAGGGGTGGGGAAGGG + Intergenic
1173042210 20:39475130-39475152 CTGTGAGGAGGTGTGGAGGAGGG + Intergenic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1175028979 20:55933481-55933503 TTGTGAAAAATAGTGGGGGATGG - Intergenic
1175828464 20:61949805-61949827 CTGTGGTACTGGGTGGGGGAAGG + Intergenic
1175857645 20:62131138-62131160 GTGTGAAAATGGGTGGGATAAGG + Intronic
1176065976 20:63195226-63195248 ATGTGATGAGGGGTGGGTGACGG + Intergenic
1176096613 20:63347272-63347294 CTGCAAAACGGGGAGGGGGATGG - Intronic
1176185768 20:63778013-63778035 CTGCAAAAAGGGGCTGGGGAGGG + Intronic
1176520275 21:7819102-7819124 CTGTTGTAAGGGGTGGGGGGTGG - Exonic
1177197994 21:17923108-17923130 CAGTGAGCAGGGGTGGGGGTTGG + Intronic
1179005177 21:37507660-37507682 CAAAGAAAAGGGGTGGGGGGAGG - Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179420142 21:41228995-41229017 CTTTGGAAAGTGGTGTGGGATGG + Intronic
1179593245 21:42425252-42425274 CTGTGAACATGGGTGACGGAAGG - Intronic
1179625172 21:42645195-42645217 CTGCGCAAAGGGGATGGGGAGGG + Intergenic
1179709475 21:43204838-43204860 CACTGAGAAGGGGTGGGTGAGGG - Intergenic
1181556266 22:23673427-23673449 CTGTGGATTGGGGTGGGGCAGGG - Intergenic
1181637708 22:24181987-24182009 ATGGGAAATGGGGTGGGGGACGG - Intronic
1181660759 22:24346615-24346637 CAGTGATAGGGGGTTGGGGACGG + Intronic
1181698083 22:24603862-24603884 CTGTGGATTGGGGTGGGGCAGGG + Intronic
1181873939 22:25925227-25925249 TTTTAAAATGGGGTGGGGGAGGG - Intronic
1181962236 22:26630482-26630504 CAGTGAACAGGGGTGCGGCACGG + Exonic
1182185401 22:28396490-28396512 CATTAAAAAGGGGTTGGGGAGGG - Intronic
1182269029 22:29141846-29141868 CTATGAAATGGGGTGGGGCAAGG - Intronic
1182525932 22:30919306-30919328 CCATGAACTGGGGTGGGGGATGG - Intergenic
1182564182 22:31184922-31184944 CCGTGCAAAGGGGAGAGGGAGGG + Intronic
1182639413 22:31754312-31754334 CTGTGAAACGGAGTCAGGGAAGG + Intronic
1182780891 22:32866664-32866686 CTGTGATAAAAGGTGGGGAAGGG + Intronic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1183513869 22:38251778-38251800 GTGGGGAAAGGGGTGGGGAAGGG + Intronic
1183537360 22:38410696-38410718 CGGGGAGAAGGGGAGGGGGAGGG + Intergenic
1183649832 22:39147528-39147550 CTGAGAAAGAGGGTGGGGGGTGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183686141 22:39362408-39362430 GTGTGAGGCGGGGTGGGGGAGGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184395710 22:44237417-44237439 GTCAGAAAAGGGGTGGGGGTGGG - Intergenic
1184488074 22:44793257-44793279 GTGTGAAGCAGGGTGGGGGATGG + Intronic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
949101109 3:146255-146277 TTTTAAAAAAGGGTGGGGGACGG + Intergenic
949355458 3:3176028-3176050 ATGTGAAAAGGAGGGGGGAAAGG - Intronic
950087996 3:10274595-10274617 CTGTGTGTAGGGGTCGGGGAGGG + Intronic
950099193 3:10346720-10346742 CAGTGGAAAAGGGTGGGTGAAGG + Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950845511 3:16011870-16011892 CTTAGAAAAGGGGAGGGGGCTGG + Intergenic
950873787 3:16251740-16251762 CTGTAAAATGGGGTGGCGGTAGG - Intergenic
951927219 3:27921622-27921644 CTCTGCATGGGGGTGGGGGAAGG + Intergenic
952213635 3:31254114-31254136 GAGGGAAAAGGGGTGGGGGGAGG - Intergenic
952706136 3:36380225-36380247 CCCTGGAAAGGGCTGGGGGAAGG - Intergenic
953179427 3:40582369-40582391 CTGTGCAAAGGGGGAGGGGCAGG + Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953796540 3:45990300-45990322 CTGTGAAAAGGGGCAGTGGGTGG + Intronic
953875241 3:46662826-46662848 CTCTGAAGATGGGTGAGGGAGGG + Intergenic
954036878 3:47855592-47855614 CTGTGGCATGGGGTGGTGGAAGG - Intronic
954274433 3:49533100-49533122 CTGTGAAGGGCGGTGGGGGCTGG - Exonic
954330960 3:49890061-49890083 CTGTGGAAAGGGGGAGGTGAGGG + Intronic
954364538 3:50139039-50139061 GTGTGAATAGGGGGAGGGGAAGG + Intergenic
954766851 3:52925598-52925620 CTGTGAAACGGGGTAGGGCAGGG + Intronic
955406759 3:58630610-58630632 CTGTGGGAAGGAGTGGAGGAAGG - Intergenic
955479140 3:59371515-59371537 CTTTGGAGAGGGGTGGGGAATGG - Intergenic
955514341 3:59711805-59711827 TGGTGCAAAGGGGTGGGGAATGG + Intergenic
955772731 3:62402220-62402242 CTAAGAAACGGGGTGGGGGCGGG + Intronic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
956721025 3:72117594-72117616 CTGTGTAAAGGAGAGAGGGAAGG + Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957788727 3:84913820-84913842 CTGAGAAAGGGGGTGGGGTGGGG - Intergenic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
959381365 3:105644942-105644964 CTAAGAGAAGGGGTGGGGGTGGG + Intergenic
959412891 3:106047082-106047104 TAGTGATAAGGTGTGGGGGATGG - Intergenic
959942662 3:112095805-112095827 AGGTTAAAAGGGGTGGGGCAGGG + Intronic
960195277 3:114759298-114759320 CAGTGGAAAGGGGATGGGGAGGG + Intronic
960405380 3:117253210-117253232 CTTTGAAAAGGGTTGAGGGGAGG - Intergenic
960541561 3:118867456-118867478 TTGGGAAATGGGGTGGTGGAGGG + Intergenic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
960940662 3:122931150-122931172 TTGGGAAAAGGGGTGGGCTATGG - Intronic
961779281 3:129312217-129312239 CTGGGAAAAAGGGAGGGGAAGGG + Intergenic
962288934 3:134114023-134114045 CAGTGAATGGGGGTGGGGGTGGG - Intronic
962315290 3:134355529-134355551 GTGGGAAAAGGAGTGGGGGAAGG + Intergenic
962990948 3:140577018-140577040 CTATGAAAAGGAGTGGGGAGGGG - Exonic
963599470 3:147365182-147365204 CAGTAAAAGAGGGTGGGGGAAGG + Intergenic
963637020 3:147810906-147810928 CAGGGGAAAGGGGTGGGAGAAGG + Intergenic
963693579 3:148536229-148536251 CTATGTAAAAGAGTGGGGGAAGG + Intergenic
964833362 3:160910316-160910338 CTGTCAAAAAGGGGAGGGGAGGG - Intronic
965528599 3:169747825-169747847 CAGGGAATAGGGGTGGTGGAGGG - Intergenic
965693298 3:171380662-171380684 TTGTGAAGAGGGGTGGGGACAGG - Intronic
965890288 3:173505038-173505060 CGGGGGCAAGGGGTGGGGGAAGG - Intronic
966176071 3:177138913-177138935 CTGTGAAATGGGGTCAGGTATGG - Intronic
966973580 3:185066655-185066677 CTGTGGGAAGGGGTGGGGATAGG + Intergenic
967089567 3:186124019-186124041 CTGTGAAAAGGGACGGGGTTGGG + Intronic
968338522 3:197934796-197934818 TTGTGAGATGGGGTGGGGGGAGG - Intronic
968369563 3:198214586-198214608 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
968369962 3:198218000-198218022 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
969143356 4:5099500-5099522 CTGTGAAAAGTGGTGTGGCAGGG + Intronic
969285530 4:6200017-6200039 GTCTGAAGAGGAGTGGGGGATGG + Intronic
969339169 4:6529625-6529647 CAGGGAAGAGGGATGGGGGATGG - Intronic
969371536 4:6734367-6734389 GTGTGAAATGAGGTTGGGGAGGG - Intergenic
969398755 4:6939731-6939753 CTGAGGAGAGGGGTGGGGGTGGG + Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
969713854 4:8859190-8859212 CTGTCAAGAGGCGTGGGGGGGGG - Intronic
969759720 4:9173317-9173339 CTGTGTATCGGGGTGGGGGTGGG + Intronic
969846757 4:9925443-9925465 CTGTGGAAAGGGGTGGGCCTTGG + Intronic
970163195 4:13209779-13209801 AAGTGAAAAGGGGTGGGGCTGGG - Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970539542 4:17063668-17063690 TTGTGAGAAAGGGTGGGGGCTGG + Intergenic
970644008 4:18098581-18098603 CTGTGGGAAGGGGTCAGGGATGG + Intergenic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
971057304 4:22927911-22927933 CTGAGAAAAAGAGTGGGGCAAGG - Intergenic
971294868 4:25379089-25379111 CTGGAAAGAGGGGTGGTGGATGG + Intronic
971643296 4:29163016-29163038 CTGTGGAAAGTGGGGGGGGGGGG + Intergenic
972414258 4:38823485-38823507 CTGTTAAAAGGAATGGGGCATGG - Intronic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
972924961 4:43992758-43992780 CAGTGAATGGTGGTGGGGGAGGG + Intergenic
973110489 4:46390862-46390884 CTGTGAAAAGAGGTTGGAAAAGG - Intronic
973263092 4:48184543-48184565 TTGAGAAAAGAGGTGGGAGAGGG - Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973646115 4:52952820-52952842 CTGGGAAAAGGTGGGGGAGAAGG - Intronic
973669131 4:53196737-53196759 CCATAAAAAGGGGTGGGGGAAGG + Intronic
975132341 4:70842029-70842051 CTGGGAGAGGGGGTGTGGGAAGG + Intergenic
975249362 4:72160256-72160278 CATTGACCAGGGGTGGGGGATGG - Intergenic
975369439 4:73567977-73567999 CTGTGGAAAGGGGAGGGAGGAGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975834854 4:78411785-78411807 ATTAGAAAAGGGGTGGCGGAGGG - Intronic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
976228354 4:82814859-82814881 CTCTCAAAAGAAGTGGGGGAGGG - Intergenic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
977177394 4:93834283-93834305 TTGTGAAAAGGGTTAGGAGATGG + Intergenic
978430084 4:108624370-108624392 ATGGGAAATGGGGTGGGGGAAGG + Intronic
979134043 4:117085929-117085951 TCTTGAAAAGGGGTGGGGGAGGG - Intergenic
979233030 4:118368028-118368050 CTGAGAAAAGAGGTAGGAGAGGG + Intergenic
979472205 4:121111955-121111977 CTTTAAAAATGGGTGGGGCATGG - Intergenic
979490020 4:121315286-121315308 CTGTTAAAATGAGTGGTGGATGG - Intergenic
980491518 4:133533698-133533720 CGGGGAGAAGGGGTGGGGGGCGG + Intergenic
980699182 4:136401577-136401599 GTGTAAAAAGGTGTCGGGGATGG - Intergenic
981015735 4:139972214-139972236 TTGTGGAGAGTGGTGGGGGAAGG - Intronic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
981993522 4:150953375-150953397 CCGTGCAAAGAGGGGGGGGAGGG - Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982316893 4:154041180-154041202 CTGTGAAAATGGGTGGTGTGTGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
986606483 5:9528380-9528402 ATGAGAAATGGGGTGGGAGATGG + Intronic
986733941 5:10654311-10654333 CTGTGCACAGGGGTGGGGCTCGG + Intergenic
986837783 5:11660218-11660240 CCATGAAAAAGGATGGGGGAAGG + Intronic
986929883 5:12805100-12805122 CTGAGAAAAGGGTAGGGGAAGGG - Intergenic
987287857 5:16476747-16476769 CTGTCAATAGGGTTGGGGGTGGG + Intronic
987329614 5:16844828-16844850 CTAAGAAATGGGGTGGGGGGTGG + Intronic
987390243 5:17368554-17368576 CTTTGAAATGGGGTGGATGAGGG + Intergenic
987508136 5:18799826-18799848 ATGTAAAAAGGTTTGGGGGAAGG - Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
989228245 5:39055419-39055441 ATGTGAAAAAGAGTGGGGGGGGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989258159 5:39389251-39389273 ATATGAAAAGGGGAGGGGAACGG - Intronic
989330326 5:40250772-40250794 CTGGGAAGAGTGGTGGGGGGTGG + Intergenic
989600231 5:43193455-43193477 ATGAGGAATGGGGTGGGGGAGGG - Exonic
989663631 5:43825349-43825371 CCGTGCAAAGGGTAGGGGGAGGG + Intergenic
989778595 5:45237999-45238021 GTGTGATGGGGGGTGGGGGAGGG - Intergenic
990014367 5:51041057-51041079 CTGGGAGAAGGGGTGGGGTTGGG + Intergenic
990238880 5:53797419-53797441 TTTTGAAAAGGGTTGGGGGGAGG - Intergenic
990522040 5:56589657-56589679 CTGTGAAAATGACTGGGGAATGG + Intronic
990792453 5:59496555-59496577 CTCTGAAAAGTGGTAAGGGAAGG + Intronic
991927508 5:71719526-71719548 CTGGGAATAGGAGTGGGGGTGGG - Intronic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
992772318 5:80060046-80060068 CTGAGACAAGGGATGGCGGAAGG + Intronic
993110141 5:83646693-83646715 CTGTGGTGAGGGGTGAGGGAAGG + Intronic
993335050 5:86646603-86646625 AAGTGAAAAGGGCTGTGGGAAGG + Intergenic
993520025 5:88889386-88889408 GGGAGAAAAGGGGGGGGGGAAGG - Intronic
993680543 5:90872760-90872782 CTCTGTAAAGGGGTGGAGAAGGG - Intronic
993727425 5:91383777-91383799 GTGTGAAGAGAGATGGGGGAAGG + Intergenic
993868230 5:93219855-93219877 CTGTGTGGAGGGGTGGGGGTGGG - Intergenic
994894497 5:105685304-105685326 ACGTGAATAGGGGTGGGTGAAGG - Intergenic
994995948 5:107063302-107063324 CAGGGAAGAGGGGTGGGAGAAGG + Intergenic
995523394 5:113031682-113031704 GTGTGGATAGGAGTGGGGGAGGG - Intronic
995540778 5:113183903-113183925 TTGTGAAGATGGGTGGGGGCGGG - Intronic
995731493 5:115247849-115247871 CTGTGAAAAGGTCTGTGGAATGG + Intronic
995813738 5:116141689-116141711 CTGGGAAGAGGGGTGGTGGCTGG + Intronic
996522036 5:124438100-124438122 CTGGCACACGGGGTGGGGGAGGG + Intergenic
996551926 5:124740047-124740069 CTGTAAAAAACGGTGGGGGGAGG - Intronic
996978047 5:129459225-129459247 GTGTGTAATGGGGTGGGGTAGGG + Intergenic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
997485013 5:134223743-134223765 GTATGAAAAGGTGTGGGAGATGG - Intronic
997650230 5:135511850-135511872 CTATGCAATGTGGTGGGGGAAGG - Intergenic
997870434 5:137501131-137501153 TTTGGAAACGGGGTGGGGGATGG - Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998245838 5:140504051-140504073 CTAAAAAAAAGGGTGGGGGAGGG - Intronic
998537210 5:142944931-142944953 CTGAGCAATGGGGTTGGGGAGGG - Intronic
998978371 5:147673162-147673184 GAGAGAAAAGGGGTGGGGGAAGG + Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999113566 5:149142135-149142157 ATGGGAACAGGGGTGGGGGCGGG + Intronic
999201130 5:149817026-149817048 TGGTGACCAGGGGTGGGGGATGG - Intronic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000439197 5:161247200-161247222 CTGAGAATGGGGGTGGGGGGTGG - Intergenic
1000987462 5:167876272-167876294 CTGAAACAAGGGCTGGGGGAAGG + Intronic
1002728842 5:181320171-181320193 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1002729241 5:181323578-181323600 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1002934203 6:1657906-1657928 CTTTAAAAAGGGGAGGGGGATGG - Intronic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1003987150 6:11448250-11448272 AAGAGGAAAGGGGTGGGGGAAGG + Intergenic
1004149003 6:13097339-13097361 AGGTGAAGAGGGGTGGGGGCAGG - Intronic
1004504479 6:16237197-16237219 CTCATAAAAGGGGTGGGGGCAGG - Intergenic
1004775892 6:18844467-18844489 CTGTGAAAAGGTGTTTGGGAAGG + Intergenic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005695629 6:28350174-28350196 CTGCGAGAAGCCGTGGGGGAGGG + Intronic
1005710703 6:28501544-28501566 CCGTGCAAAAGGGAGGGGGAGGG - Intergenic
1005763175 6:28986344-28986366 CTGAGGAATGGGGTGGGGGTAGG - Intergenic
1005841150 6:29745356-29745378 CTGTGAGTAGGGGTGAGGAATGG - Intergenic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006480977 6:34293960-34293982 GTGGGAAAAGGGGTGTGGGTGGG - Intronic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1007407893 6:41645271-41645293 GGGGGAAAAGGGATGGGGGATGG - Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1012844090 6:104367838-104367860 ATGTGGCAAGAGGTGGGGGAAGG + Intergenic
1013098082 6:106964098-106964120 ATTTGAAAAGTGGTGAGGGAGGG - Intergenic
1013231953 6:108167800-108167822 GAGTGAAAGGGGGAGGGGGAGGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013371819 6:109477515-109477537 CTGGAAACAGGGGTGAGGGAGGG + Intronic
1013822849 6:114176157-114176179 TTTTGGAAAGGGGTGGGGGTGGG - Intronic
1014226951 6:118859997-118860019 CAGTGATAAGGTGTTGGGGAAGG - Intronic
1014549437 6:122772793-122772815 GTGTGAAGAGGTGTGGGGGTAGG - Intergenic
1014703764 6:124721693-124721715 CTGTGAAAGGAAGTGGGGGTGGG - Intronic
1014825973 6:126048820-126048842 CTCTAAAGAGGGGTGGAGGAAGG - Intergenic
1015038799 6:128691163-128691185 CTGGGAAGAGGGGTGGGAGTAGG + Intergenic
1015492818 6:133847354-133847376 CTGTGTTAATGGGTGGGGGCTGG - Intergenic
1015660396 6:135567872-135567894 CAGAGAAAAAGGGTGGGGGAGGG - Intergenic
1015690244 6:135914359-135914381 CTGGGAAGTGGGGTGGGGCAGGG - Intronic
1015798254 6:137034558-137034580 CTGTGAGGAGTGCTGGGGGAGGG - Intronic
1015912067 6:138178950-138178972 ATTAGATAAGGGGTGGGGGATGG + Intronic
1016415125 6:143824062-143824084 CACTGAAAAGGGGTGGGAGTTGG + Exonic
1016462068 6:144287226-144287248 CTGGTAAAAGGGGCGGGGAATGG - Intronic
1017482631 6:154872705-154872727 CCGTGGAAAGGGGTGGAGTAGGG + Intronic
1017563605 6:155660532-155660554 ATGTAAAAAGGCTTGGGGGAAGG + Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018102035 6:160448787-160448809 CTGGGAAGAGGGGTAGGGAAGGG + Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018491371 6:164297185-164297207 CCTTGAAAAGATGTGGGGGATGG - Intergenic
1018865998 6:167747628-167747650 CTGTGGAAGGGAGGGGGGGAGGG + Intergenic
1019643966 7:2119338-2119360 CTGTCAGAAAGGGTGGGTGATGG - Intronic
1019651383 7:2161117-2161139 CCGTGCAAAGGGGAGAGGGAGGG - Intronic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1021024145 7:15643479-15643501 AGGGGAACAGGGGTGGGGGAGGG + Intronic
1021217915 7:17940233-17940255 CTGTGAAATGGGGAAGGGGCCGG - Intronic
1021270980 7:18585241-18585263 AAGGGAAATGGGGTGGGGGAGGG - Intronic
1022112514 7:27240176-27240198 CGGTGGAAAGGGGCGGGGGTGGG + Intergenic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1023095611 7:36656832-36656854 ATGTAAAAAGGCTTGGGGGAAGG + Intronic
1023575824 7:41625442-41625464 TTATGAATAGGGGTGGGGGTGGG - Intergenic
1023730762 7:43190052-43190074 CTGTGACCAGGGGTGTGTGAAGG - Intronic
1024073569 7:45807016-45807038 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1024920027 7:54545823-54545845 CAGAGAGAAGGGGAGGGGGAAGG + Intronic
1025053846 7:55748514-55748536 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1025131953 7:56378987-56379009 CTGTGAAGACTGGTGTGGGAAGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1025850107 7:65238042-65238064 ATGTGAAAGTGGGTGGGGGAGGG + Intergenic
1026523838 7:71137612-71137634 ATGTGGAGAGGGGTGGGGGCTGG + Intronic
1026840335 7:73667447-73667469 CTGTAAAATGGGGTTGGAGATGG - Intergenic
1026946543 7:74319862-74319884 GTGTGAAAAGAGGTTAGGGAGGG + Intronic
1027172894 7:75885401-75885423 CTGGGAACAGGGGAGAGGGAGGG - Intronic
1027175894 7:75903247-75903269 CTGTGGAAAGGGGCTGGGCACGG + Intronic
1027272730 7:76532615-76532637 CTGGGAGCAGGGGTGGGGGGAGG - Intergenic
1027326178 7:77051700-77051722 CTGGGAGCAGGGGTGGGGGGAGG - Intergenic
1027343887 7:77237873-77237895 CTGAGACAAGAGGTGGGGGAAGG - Intronic
1027361663 7:77416176-77416198 CTGCGGAGAGGGGTGGGGGCGGG - Intronic
1027476925 7:78643727-78643749 ATGGCACAAGGGGTGGGGGATGG + Intronic
1029124671 7:98287874-98287896 CTGGGCAAAGGGGTGTGGGTGGG - Intronic
1029615021 7:101650831-101650853 CAGAGACAAAGGGTGGGGGAGGG - Intergenic
1029927224 7:104329694-104329716 CTGGGAAAGGGGGCGGGGGGCGG + Intronic
1030043222 7:105470748-105470770 CTGTCAAAAGGTGTGTGGAAGGG - Exonic
1030460917 7:109835034-109835056 ATGTGAACAGGGGTGGGAAATGG - Intergenic
1030632036 7:111906708-111906730 CCTTGAAAAAGGGAGGGGGAAGG + Intronic
1030934649 7:115570455-115570477 TTTTAAAAAGGGGAGGGGGATGG - Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032050966 7:128650714-128650736 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1032480595 7:132243670-132243692 CTGTGAATTGGGGTGGGGGTGGG - Intronic
1032695762 7:134334850-134334872 GTTTGAAAAGGGGTGGGGATGGG - Intergenic
1033293897 7:140114178-140114200 CCGTGGAAAGGGGAGGGGAAGGG - Intronic
1034292786 7:149945928-149945950 CTGGGAACAGGTGTGGAGGAGGG + Intergenic
1034571275 7:151958505-151958527 TAGTGAAACGGGGTTGGGGAGGG + Intronic
1034678172 7:152907558-152907580 CAGTCAGAAGGGGTGAGGGAGGG - Intergenic
1034704361 7:153127358-153127380 CTGTGAAATGGGGTGAAGGCAGG + Intergenic
1035091379 7:156315530-156315552 AAGAGAAAAGGGGAGGGGGAGGG - Intergenic
1035204807 7:157288343-157288365 ATGTGAGAGGGGGTAGGGGAAGG + Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1036661698 8:10713457-10713479 CGGAGAAAAGGTGTGGGGAAAGG + Intergenic
1036789152 8:11706757-11706779 CAATCAGAAGGGGTGGGGGAAGG - Intronic
1037408017 8:18564686-18564708 CTGTGGAAATGGGTGGGTGGGGG + Intronic
1038147547 8:24913072-24913094 TTAAGACAAGGGGTGGGGGAAGG + Exonic
1039090436 8:33822660-33822682 CTGGGAAGAGGGGTGCGTGATGG - Intergenic
1039120856 8:34144670-34144692 CTCTTAAATGGGGTTGGGGATGG + Intergenic
1041206019 8:55498477-55498499 CTGTGAAACGGGGTGATGCAGGG + Intronic
1041450719 8:58004030-58004052 CTGGGGGATGGGGTGGGGGAGGG + Intronic
1041666900 8:60454605-60454627 ATGAGAAAAAGGGTGGAGGATGG + Intergenic
1042852154 8:73226914-73226936 CTGTGAACAGGGGTTGGCCATGG + Intergenic
1043132117 8:76474399-76474421 CGGTGAATAAGGGTGGGGGATGG + Intergenic
1043427586 8:80163442-80163464 CTGTTACCAGGGGTAGGGGATGG + Intronic
1044517618 8:93157212-93157234 CTGGGAAAAGGGGTGAAGGATGG + Intronic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1046157374 8:110310299-110310321 CAGTGAAAAGTGTTGGGGGGTGG - Intergenic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1046953978 8:120044573-120044595 CTGTGAATAGGGGGAGGGCAGGG + Intronic
1047319349 8:123765023-123765045 CTGTGCAAAGGTCTGGGGAAAGG + Intergenic
1047473426 8:125201912-125201934 CGGGGGAATGGGGTGGGGGACGG - Intronic
1047838615 8:128721697-128721719 GTGGGAGTAGGGGTGGGGGAGGG - Intergenic
1048239737 8:132729668-132729690 CTGCCAAAAGGGGTGGGGAGAGG + Intronic
1048338431 8:133520474-133520496 CTGTGAAAAGCTGTTGGGTATGG + Intronic
1048468246 8:134685171-134685193 CTGTAAAAAGGGGATGGTGACGG - Intronic
1049200226 8:141336462-141336484 CTGGGAAGTGGGGTTGGGGAGGG + Intergenic
1049412696 8:142480415-142480437 CTGTGGGGAGGTGTGGGGGACGG + Intronic
1049493667 8:142918054-142918076 CTGAGAAAAGGCGTGGGGTCTGG + Intergenic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1051332718 9:16039854-16039876 GTGTGTAATGGGGTGGGGGGTGG + Intronic
1052473545 9:28930071-28930093 GTGTGAAAAGGGGTAGAGCAGGG - Intergenic
1053088946 9:35255305-35255327 CTATAAGATGGGGTGGGGGAGGG - Intronic
1053195024 9:36110789-36110811 ATGTGGAGAGGGGTGGGGGCCGG + Intronic
1053225892 9:36356722-36356744 CTATGAAAAAGGGTTGGGGCGGG + Intronic
1054840353 9:69731728-69731750 CTCTGAAAAGGGGGAGAGGAGGG - Intronic
1055105164 9:72504641-72504663 CTGTGAGCAGGAGTGGGGTAAGG + Intergenic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057314071 9:93958024-93958046 CTGTGGAATGGGGTGAGGGCTGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058201291 9:102044829-102044851 CTGGGAAAGGTGGTGTGGGAAGG - Intergenic
1058426916 9:104883330-104883352 CAGTGATGATGGGTGGGGGAGGG - Intronic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1058638062 9:107056195-107056217 TTGTGAGTTGGGGTGGGGGAGGG + Intergenic
1059395378 9:114031231-114031253 CTAGGGAAAGGGGTGGGGGTGGG - Intronic
1059451146 9:114372166-114372188 CTGAGAGAGGGGTTGGGGGAGGG + Intronic
1059756868 9:117302075-117302097 TTGAGAAAAGTGGTGGGGGTGGG + Intronic
1061339030 9:129963908-129963930 CTGTGAAAAAGGCTGGGGCTGGG - Intronic
1061482423 9:130903556-130903578 CAGGGAAACGGGGTGGGGGTTGG + Exonic
1061600746 9:131668560-131668582 CTGTGAAAATGGGAGGGGAGGGG - Intronic
1062753902 9:138277270-138277292 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203576421 Un_KI270745v1:12049-12071 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203576818 Un_KI270745v1:15458-15480 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1203577220 Un_KI270745v1:18880-18902 CTGTGAAGACTGGTGTGGGAAGG + Intergenic
1185608416 X:1380411-1380433 GGGGGAAAAGGGGAGGGGGAGGG + Intronic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185749964 X:2603059-2603081 CTGTGAAAAGGTCGGGGGTAGGG + Intergenic
1186349796 X:8730583-8730605 CTGGGTCAAGGGGTGGGGGGGGG - Intronic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186502767 X:10065222-10065244 GTGTGAAAAGGGGTGAGCAAAGG + Intronic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187625051 X:21102002-21102024 CTGGGAAAAGCAGTGGGGGTGGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188450869 X:30307447-30307469 CAGTAAAATGGGGTGGGGGGAGG + Intronic
1188683428 X:33040335-33040357 CTGTTCAGAGGGGTTGGGGAAGG + Intronic
1189391120 X:40577700-40577722 CTATGGAAAGGTGTGGGGGAGGG - Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190136900 X:47806247-47806269 CTGGGAAAAGTGGGGAGGGAGGG - Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190599070 X:52070935-52070957 CTGTGAAGATGGGTTGGGGGGGG - Intergenic
1190609754 X:52183138-52183160 CTGTGAAGATGGGTTGGGGGGGG + Intergenic
1191225185 X:58035080-58035102 CAGTGAGAAGGGGTGGGTCAAGG + Intergenic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1191969720 X:66799577-66799599 CTGTGAAAAGGGGTGGCTGTGGG + Intergenic
1192188799 X:68978293-68978315 CGGTGGACGGGGGTGGGGGAGGG - Intergenic
1192343097 X:70280372-70280394 CTGGGAGAAAGGGTGGGGAATGG - Intronic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1192561849 X:72132430-72132452 CTGAAAAAAGGGGCTGGGGATGG - Intergenic
1192844496 X:74891874-74891896 CTGTGAAAGGGTGAGGGGAAAGG - Intronic
1193636249 X:83952765-83952787 CAGGGAAAAGGGTTGGGGGGTGG + Intergenic
1193745704 X:85277568-85277590 CTGGGAAAAGGGGTGTGCGAGGG - Exonic
1194319904 X:92432646-92432668 CTGTTAAAAAGGGGGAGGGAGGG + Intronic
1195007217 X:100697770-100697792 AGGGGAAAAGGGGTAGGGGAGGG + Intronic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195687034 X:107596912-107596934 CTCTGAAAAGGGGTGGGGACAGG + Intronic
1196421624 X:115528124-115528146 CAGTATAAATGGGTGGGGGAGGG - Intergenic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196669276 X:118348049-118348071 GTGTGTATTGGGGTGGGGGAGGG + Intronic
1197152510 X:123235233-123235255 CTCAGAAAAGGGGAGGGGCAGGG + Intronic
1197387232 X:125816376-125816398 CTGTGTACAGGGGTTGGGGGTGG - Intergenic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197990667 X:132313365-132313387 CAGTAAAATGGGGTGGGGGGAGG - Intergenic
1198178069 X:134174572-134174594 CTGGGAGGAGGGGTGGGAGATGG - Intergenic
1198184484 X:134240055-134240077 CAGTGAAAAAGGGTGGAGAATGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199860790 X:151798921-151798943 CTGTGGAGAGGGGTGGAGGGAGG + Intergenic
1200042280 X:153379198-153379220 CAGTGAATGGGGGTGGGGGATGG + Intergenic
1200069194 X:153519468-153519490 CTGTGAAAAGTGGCGGCGGGGGG - Intronic
1200216282 X:154369502-154369524 CTGGGGAAAGGGGGGTGGGATGG - Intronic
1200282143 X:154786062-154786084 CTGGCATAATGGGTGGGGGAGGG - Intronic
1200628029 Y:5545779-5545801 CTGTTAAAAAGGGGGAGGGAGGG + Intronic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic