ID: 1184186327

View in Genome Browser
Species Human (GRCh38)
Location 22:42867636-42867658
Sequence CTTCTGAGTGGACCAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184186320_1184186327 9 Left 1184186320 22:42867604-42867626 CCCAGGCTGCCCAGTCGGGCCTT 0: 1
1: 1
2: 1
3: 22
4: 300
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186324_1184186327 -10 Left 1184186324 22:42867623-42867645 CCTTCACTACATGCTTCTGAGTG 0: 1
1: 1
2: 0
3: 19
4: 181
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186323_1184186327 -1 Left 1184186323 22:42867614-42867636 CCAGTCGGGCCTTCACTACATGC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186315_1184186327 27 Left 1184186315 22:42867586-42867608 CCTGAGGCCTTGACACAGCCCAG 0: 1
1: 0
2: 2
3: 28
4: 274
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186317_1184186327 20 Left 1184186317 22:42867593-42867615 CCTTGACACAGCCCAGGCTGCCC 0: 1
1: 0
2: 9
3: 44
4: 367
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186322_1184186327 0 Left 1184186322 22:42867613-42867635 CCCAGTCGGGCCTTCACTACATG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138
1184186321_1184186327 8 Left 1184186321 22:42867605-42867627 CCAGGCTGCCCAGTCGGGCCTTC 0: 1
1: 0
2: 1
3: 13
4: 209
Right 1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184186327 Original CRISPR CTTCTGAGTGGACCAGGATC TGG Intronic
900679929 1:3911119-3911141 CTTCTGAGCAGTCCAGGATGGGG + Intergenic
900809513 1:4790884-4790906 CTTCTGAGAAGACCAGTATTTGG - Exonic
901449970 1:9329970-9329992 GTTCAGAGTGGCCCAGGAGCAGG + Intronic
909881795 1:80889219-80889241 TTTCTGAGGGGACTGGGATCTGG - Intergenic
910209217 1:84776437-84776459 CATCTGGTTGGACCAGCATCTGG + Intergenic
912037778 1:105343503-105343525 CTTCTCAGTGGGACAGGATGTGG + Intergenic
914461706 1:147891207-147891229 CTTCTGTGTTGGCCAGGATGGGG - Intergenic
916168864 1:161985869-161985891 CTTCTGAGTGGCTCTGGATCCGG + Intronic
918439405 1:184551520-184551542 ATTCTGGAAGGACCAGGATCTGG + Intronic
922023670 1:221730416-221730438 CTTCAGAATGGACCACCATCAGG - Intronic
922886392 1:229024096-229024118 CTTGTCAGTGCACCAGGTTCTGG + Intergenic
924372769 1:243371070-243371092 CTTCAGAGTGAACCAGGCCCAGG + Intronic
1062797595 10:356488-356510 CCTCTGAGAGGAACAGGAACTGG + Exonic
1063686875 10:8245267-8245289 ATTCTGAGTGGCACAGGAACCGG + Intergenic
1064932236 10:20640703-20640725 CTTCTCAGTGGGCCTGGATTTGG - Intergenic
1066298206 10:34074687-34074709 CTTAGGAGGGGACCAGGCTCTGG + Intergenic
1066314458 10:34230276-34230298 CTGCTGGGTGGACCAGGCCCTGG - Intronic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1077934578 11:6770059-6770081 ACTCTGAGTTGACCAGGATAGGG - Intergenic
1078469710 11:11577259-11577281 CTGCTGAGTCCACCAGGGTCTGG - Intronic
1081733067 11:45384954-45384976 CCTCTGAGTGGAGAAGGATGAGG + Intergenic
1085641213 11:78194081-78194103 CTTCTGAGCAGGCCAGGATTTGG + Intronic
1086461840 11:87013752-87013774 CTTCTGAATAGACCAGGATGGGG + Intergenic
1088282384 11:108148675-108148697 CTTCTAACTGAACCAGGAGCTGG + Intergenic
1089205975 11:116763089-116763111 CCTCTGAGGGGAGAAGGATCCGG + Exonic
1089575094 11:119436581-119436603 TTTCTGAGTGGACAAAGATAAGG - Intergenic
1090458859 11:126872073-126872095 TTGCTGATTGGAGCAGGATCTGG + Intronic
1092933936 12:13342538-13342560 CTTCTGTGTGTCCCAGGGTCTGG - Intergenic
1093651263 12:21648303-21648325 CCTCTGAGTGTACCAAAATCTGG + Intronic
1102430581 12:112879793-112879815 TTTCTGTGTGGACCAGGCTTGGG - Intronic
1104963169 12:132497749-132497771 CTTCTTAGTGGCCCGGGGTCAGG + Intronic
1106704067 13:32261792-32261814 GGTCTGAGTGCTCCAGGATCTGG - Exonic
1111436526 13:88216946-88216968 CCTCAAAGTGGATCAGGATCTGG + Intergenic
1113411750 13:110096025-110096047 CATCCGGGTGGACCAGCATCTGG + Intergenic
1116463891 14:45210718-45210740 CTTCTGATTAAACCTGGATCTGG + Intronic
1118265867 14:64294521-64294543 CTTGTGGGTGGACCAGGAGTCGG - Intronic
1119081410 14:71697765-71697787 CTTCTGAGTAGGGCAGGATGGGG - Intronic
1119288462 14:73475269-73475291 CTTCTGTTTGGACCAGCATGTGG - Intergenic
1121546851 14:94769286-94769308 CTTCTAAGTGGAAGAGGGTCGGG - Intronic
1122401030 14:101467517-101467539 CTTCTGAGTGGAAGTGGATTTGG + Intergenic
1124175809 15:27422960-27422982 CTCCTGTGTGGCCCAGGATAGGG - Intronic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1128043304 15:64594677-64594699 ATTCTGATTGGACCAGCTTCTGG - Intronic
1128477504 15:68009822-68009844 CTTCTTTGTGTCCCAGGATCTGG - Intergenic
1132587052 16:710162-710184 TTTCTGGGTGGCCCAGGGTCTGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1135481077 16:22821071-22821093 CTTCTGATTGGTCCGGGAGCTGG + Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140869077 16:79090208-79090230 GGTCTGAGTGGGCCAGGGTCGGG + Intronic
1141506968 16:84484164-84484186 CTTGGGGGTGGACTAGGATCTGG - Intronic
1142721441 17:1778664-1778686 CTTCTGACTGGAACGGGGTCTGG + Intergenic
1143023598 17:3928914-3928936 CAGCTGAGTGGACAAAGATCGGG - Intronic
1143111180 17:4553911-4553933 CCTCTGTGGGGACCAGGACCAGG - Exonic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1146650545 17:34603597-34603619 ATGCTGAGTGGACCTGGGTCTGG + Intronic
1147270282 17:39264863-39264885 TTTCTGAGTTTCCCAGGATCAGG - Intronic
1148192445 17:45689014-45689036 CTTCTGACAGCTCCAGGATCCGG - Intergenic
1148258591 17:46158948-46158970 GTTCTGAGTGGACCTGGAAAGGG - Intronic
1153391024 18:4559675-4559697 CTTGTGAGTTGACCAGATTCTGG + Intergenic
1153843438 18:9027475-9027497 ACTCTGTGTGGACCATGATCAGG - Intergenic
1155250545 18:23949415-23949437 CATCTGTGAGGACCAGGGTCAGG + Intronic
1160220399 18:76973160-76973182 CTTCTGGGAAGTCCAGGATCTGG - Intergenic
1160490606 18:79334556-79334578 CTGCTGTGTGGACCAGGACGGGG - Intronic
1167421129 19:49404047-49404069 CTGCCGAGTGGCCCAGGATCTGG + Intronic
1168310847 19:55459788-55459810 GTTCTGAGGGAACCAGGAGCTGG + Intronic
928102653 2:28448584-28448606 CTTCTGTGTGGAGCAGAACCTGG + Intergenic
929621835 2:43362987-43363009 CTTTCCAGTGGACCAGGATGTGG - Intronic
931203509 2:60124288-60124310 CTGCTGAGTTGACAGGGATCTGG + Intergenic
932590080 2:73060122-73060144 TCTGTTAGTGGACCAGGATCTGG - Intronic
934569674 2:95361302-95361324 CTGCTGACTTGACCAGGATGGGG - Intronic
935639280 2:105275226-105275248 CTTCTGAGGGGTCGAGGAGCGGG + Intronic
938201447 2:129376113-129376135 CTTCAGAATGGAGCAGGCTCTGG + Intergenic
940113172 2:150177679-150177701 CCTCTGAGTGGGACAGGATGTGG + Intergenic
941900477 2:170673219-170673241 CTTCTGAGAGCAGCAGGATGAGG - Intergenic
942507924 2:176663445-176663467 TTTCTTGGTGGGCCAGGATCAGG + Intergenic
944675722 2:202033462-202033484 CATCTGAGTGCACCAGGAAGAGG + Intergenic
948335074 2:237201344-237201366 CTTCTGAGGGGACCTGGGTGAGG - Intergenic
948888317 2:240894838-240894860 CTTCTGCGTGGACCAGGGGCTGG - Intronic
1171469788 20:25361129-25361151 CTTCAGTGTGGACCAGGGACTGG - Intronic
1172112356 20:32554593-32554615 CTTCTGAGTGATACAGGACCAGG - Intronic
1172463043 20:35134617-35134639 CTTGGGAGTGGTCCAGGATTTGG - Intronic
1173158016 20:40631350-40631372 CATCTGAGGGGAGCAGGATAGGG - Intergenic
1173443348 20:43096661-43096683 CTTCTCAGTGCATCTGGATCTGG - Intronic
1175908935 20:62395468-62395490 CCTCTCTGTGGACCTGGATCAGG - Intronic
1177437449 21:21074583-21074605 CTTCTAGATGGACCAGGAACTGG + Intronic
1179360784 21:40706253-40706275 CTTCTGACTTGCCCAGGATCAGG + Intronic
1179597902 21:42455356-42455378 CTGGTGAGTGGACCAGGAGGGGG + Intergenic
1180011118 21:45052171-45052193 ATTGTGAGTGGAACAGGAGCCGG + Intergenic
1180230813 21:46425863-46425885 CTTCTGACAGCGCCAGGATCTGG - Exonic
1181031775 22:20151646-20151668 CTTCTGTGTGAACCAGGGGCAGG - Intergenic
1181673339 22:24436324-24436346 TTTCTGAGTGGAGCAGGAAACGG - Intronic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
949158322 3:852560-852582 CTTCTGGGTGTAACAGGAGCAGG - Intergenic
949381135 3:3447118-3447140 CTTCAGAGGGGCCCAGGAGCTGG - Intergenic
952872342 3:37912034-37912056 CTTCTAAGTGTATCAGGACCAGG - Intronic
954049509 3:47961935-47961957 CTGCTGATTGGAACAAGATCTGG + Intronic
975203556 4:71619257-71619279 TTTCTGAATGGACCAGTAACAGG + Intergenic
976195862 4:82530583-82530605 CTTCAGTGTGGAACAGGATGTGG - Intronic
980205394 4:129713252-129713274 TTTCTCCGTGGTCCAGGATCAGG - Intergenic
982351435 4:154419849-154419871 CGTATGAGTGGACAAGGATTGGG + Intronic
985009774 4:185570410-185570432 CTGCTGAGAGGACCATGAGCTGG + Intergenic
985378530 4:189367756-189367778 TTTCTGAGTGAACGAGGAACGGG + Intergenic
987418618 5:17691972-17691994 CTCCTCAGGGCACCAGGATCTGG - Intergenic
990348053 5:54888371-54888393 TTTCTGAGTGAACCATGTTCAGG - Intergenic
993254662 5:85574345-85574367 CTTCTAATTTGACCATGATCTGG + Intergenic
995258246 5:110072353-110072375 CTTCTGGGAGGAACAGAATCAGG + Intergenic
997310050 5:132872314-132872336 ATTCTGAGAGGACTAGAATCAGG + Exonic
997390697 5:133512695-133512717 CTTCTGAGTGTACAGGTATCTGG - Intronic
997716955 5:136049549-136049571 CTTCTGGGTCGCCCAGGATACGG - Exonic
998165809 5:139842898-139842920 CCTCTGAGTTGACCAGCAGCAGG + Exonic
998414481 5:141936340-141936362 CTCCTGGGAGGAACAGGATCAGG - Intronic
999270739 5:150295107-150295129 CTTCTCAGGGCACCAGGAACAGG + Intergenic
1001288945 5:170442984-170443006 CTTCTGTCTAGACCAGGCTCTGG - Intronic
1001327557 5:170740143-170740165 CTGCTGAGAGGAGAAGGATCTGG - Intergenic
1002312963 5:178325704-178325726 CCTCTGAGTGGCCCAGGCCCAGG + Intronic
1002759984 6:193929-193951 CCTCTGAGTGGCCAAGGATCTGG - Intergenic
1004431311 6:15546406-15546428 CTTCTGATTGGAGCAGGAAAGGG + Intronic
1005895167 6:30171863-30171885 CTTCCGAGAGAACCAGGCTCCGG - Exonic
1007050679 6:38825477-38825499 CTTCAGAATAGACCAGAATCAGG + Intronic
1007489596 6:42208759-42208781 CTACTCAGTGGGCCAGGACCAGG + Intronic
1008486868 6:52046028-52046050 AATCTGAGTGGACCAGGACAAGG + Exonic
1009424874 6:63503405-63503427 ATTCGCAGTGGTCCAGGATCTGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1021850222 7:24800809-24800831 CTTCTGAGAGGAGGAGGATGTGG + Intronic
1022800100 7:33768743-33768765 CAACTGTATGGACCAGGATCTGG + Intergenic
1023880822 7:44320400-44320422 CTTCTGAGAGGAGCAGAATGTGG + Intronic
1031877567 7:127159101-127159123 CTGCTCAGTGGACCAGGCTGTGG + Intronic
1034244679 7:149635516-149635538 CTTCTGTGTGGACCTGGCTGAGG - Intergenic
1034583788 7:152070755-152070777 TTTCTGAGGGGACCATTATCGGG + Intronic
1035281458 7:157781011-157781033 GGTGTGAGTGGACCAGGATGTGG - Intronic
1036913032 8:12774851-12774873 CCGCTGATTGGAGCAGGATCTGG + Intergenic
1039135254 8:34315356-34315378 GTTCTGAGTTGTCCAGTATCTGG - Intergenic
1044479968 8:92674380-92674402 CTTCTGAATGGACTAAGATAAGG - Intergenic
1045312742 8:101017350-101017372 CATCTGACTAGACCAGGGTCAGG - Intergenic
1053668283 9:40333345-40333367 CTCCTGTGTGGACCAGAATTTGG + Intergenic
1054379425 9:64473397-64473419 CTCCTGTGTGGACCAGAATTTGG + Intergenic
1054516329 9:66042948-66042970 CTCCTGTGTGGACCAGAATTTGG - Intergenic
1057197481 9:93123039-93123061 CTCCTGAAAGGACCTGGATCTGG - Intronic
1057476932 9:95411190-95411212 CCTCTGAATGGACCAGACTCAGG + Intergenic
1058727920 9:107821235-107821257 CTTCTCAGTAAACTAGGATCGGG + Intergenic
1059636619 9:116177768-116177790 CTCCTTAGTCCACCAGGATCTGG + Intronic
1061159594 9:128885572-128885594 CTCCTCAGTAGACCAGGTTCTGG + Intronic
1061774141 9:132949366-132949388 CCCCTGATTGGACCTGGATCAGG + Intronic
1062345148 9:136111037-136111059 CTTCTCTGTGGTCCAGGCTCAGG + Intergenic
1062451494 9:136617573-136617595 CTACTGAGTCGAGCAGCATCGGG + Intergenic
1186586137 X:10875099-10875121 CTTCTGGGAGGACCAGAACCTGG - Intergenic
1194753122 X:97706208-97706230 CATCTGAGTGCCCCAGGATCTGG - Intergenic
1200249403 X:154544605-154544627 CTTCTGAGGGGACCAGGCTGGGG + Intronic