ID: 1184186393

View in Genome Browser
Species Human (GRCh38)
Location 22:42867943-42867965
Sequence GTGGCAGCACTGATCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184186377_1184186393 30 Left 1184186377 22:42867890-42867912 CCCCCTAGTGTCAACTCAGGGGC No data
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186389_1184186393 -2 Left 1184186389 22:42867922-42867944 CCGAAGAGGTGTGGACAGTTGGT No data
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186378_1184186393 29 Left 1184186378 22:42867891-42867913 CCCCTAGTGTCAACTCAGGGGCC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186387_1184186393 -1 Left 1184186387 22:42867921-42867943 CCCGAAGAGGTGTGGACAGTTGG 0: 1
1: 0
2: 3
3: 15
4: 137
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186380_1184186393 27 Left 1184186380 22:42867893-42867915 CCTAGTGTCAACTCAGGGGCCTT 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186385_1184186393 8 Left 1184186385 22:42867912-42867934 CCTTGGGGACCCGAAGAGGTGTG 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219
1184186379_1184186393 28 Left 1184186379 22:42867892-42867914 CCCTAGTGTCAACTCAGGGGCCT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184186393 Original CRISPR GTGGCAGCACTGATCCAGGG TGG Intronic
900143112 1:1146755-1146777 CTGGCTGCACTGGTGCAGGGTGG + Intergenic
900528272 1:3139873-3139895 GGGACAGCTCTGAACCAGGGAGG - Intronic
900872949 1:5317777-5317799 GTGGCAGCACCCATCGAGGTGGG - Intergenic
900969185 1:5980125-5980147 GTGGGAGGACTGGGCCAGGGAGG - Intronic
901462740 1:9401181-9401203 CTGGCAGCACTGACCCAGGCTGG - Intergenic
903053728 1:20620437-20620459 GTGGCAACACTGGATCAGGGTGG - Intergenic
903488505 1:23709474-23709496 CTGGCAGCACTGCTCCAGAGAGG - Intergenic
903620027 1:24691269-24691291 TTGGTAGCACTCTTCCAGGGTGG + Intergenic
904191960 1:28752390-28752412 GAGGCAGCCCTGAACCCGGGAGG - Intronic
904942233 1:34172227-34172249 GTGGCAGTAGTGGTCCAGTGAGG - Intronic
905384884 1:37595730-37595752 GCGGCAGGGCTGATCGAGGGTGG - Intronic
905404709 1:37725006-37725028 GTGGAAGGACTGATCCTGGCTGG + Intronic
908794377 1:67816636-67816658 GGGGCAGCAGTGAGCCAGAGGGG + Intronic
909363220 1:74789555-74789577 GTGGCCACACTTCTCCAGGGAGG - Intergenic
913558329 1:119992011-119992033 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
913639512 1:120798440-120798462 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
914278936 1:146151501-146151523 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914539983 1:148602443-148602465 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914626663 1:149468774-149468796 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
915307600 1:154989608-154989630 GAGGCTGTACTGAGCCAGGGAGG - Exonic
915766823 1:158371564-158371586 GTGGTAGCAGTGAGCCAGGTAGG - Intergenic
916022779 1:160808450-160808472 GGGGCGGAACTGCTCCAGGGAGG - Intronic
920604569 1:207368668-207368690 GTGGTAGCTCTGCCCCAGGGAGG - Intergenic
920604974 1:207372269-207372291 GTGGTAGCTCTGCCCCAGGGAGG - Intergenic
921783843 1:219202336-219202358 GTGGTACCACTGTTCCAGTGTGG - Intronic
922962028 1:229655830-229655852 GTGTCAGCATTTGTCCAGGGAGG + Intronic
924325976 1:242894146-242894168 GAGGCAGCAAGGATACAGGGAGG + Intergenic
1063172942 10:3526104-3526126 GTGGGAGCAGAGAGCCAGGGTGG + Intergenic
1065184585 10:23159463-23159485 GAAGCAGCACAGAACCAGGGAGG - Intergenic
1067094893 10:43293942-43293964 GGGGCTGCTCTGGTCCAGGGAGG - Intergenic
1067794030 10:49307876-49307898 CTGGCATCACAGACCCAGGGAGG - Intronic
1068657978 10:59593836-59593858 GTGGCAGCAGTGCCCCAGGCAGG - Intergenic
1069546866 10:69335068-69335090 GAGGCAGCCCTGATCTAGTGGGG - Intronic
1069715321 10:70517160-70517182 GTGGCAGCAGAGGTCCAGAGAGG + Intronic
1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG + Intronic
1071823165 10:89298156-89298178 GTGGCAGCAGTGGGCCAGGTGGG - Intronic
1073288821 10:102403333-102403355 GAGGCAGCACTGGCCCAGGCCGG - Exonic
1075861183 10:125678530-125678552 GTGGCAGCAATGAACGAGGCAGG + Intronic
1076890481 10:133280867-133280889 GGGGCAGCACTGGGCCAGGGCGG + Intronic
1076890503 10:133280937-133280959 GGGACAGCACTGGGCCAGGGCGG + Intronic
1076890560 10:133281131-133281153 GGGACAGCACTGGGCCAGGGCGG + Intronic
1076910147 10:133383713-133383735 GTGGGAGGACTGAGCCAGGGAGG + Intronic
1077596288 11:3534555-3534577 GTGGCAGCACTGGGCCAGGTGGG - Intergenic
1077874347 11:6291373-6291395 GTGACAGCAGTGTCCCAGGGTGG - Intergenic
1078428944 11:11272486-11272508 AAGGCAGCACTGAGCCATGGAGG - Intronic
1078619662 11:12895387-12895409 GTGGCATCCTTGATCCAGGTAGG + Intronic
1080639150 11:34148745-34148767 GTGGAAGCACTGAAGCAGGCCGG - Intergenic
1081553304 11:44134077-44134099 GTGGCAGCACTGCTCACTGGTGG - Intronic
1083063455 11:59898540-59898562 AGGGCAGCACAGTTCCAGGGAGG + Intergenic
1083473487 11:62900332-62900354 ATGGTAGCATTGACCCAGGGTGG + Intergenic
1084252196 11:67908532-67908554 GTGGCAGCACTGGGCCAGGTGGG - Intergenic
1084420667 11:69059034-69059056 GTGGCAGAAGAGATCCAGGCAGG - Intronic
1084820653 11:71687501-71687523 GTGGCAGCACTGGGCCAGGTGGG + Intergenic
1086184750 11:83999496-83999518 GTTGCAGCAGTGAGCCAGGCAGG - Intronic
1088812284 11:113399893-113399915 GTGTCAGCACTGCTGCAGTGTGG + Exonic
1089264970 11:117252340-117252362 GGGGCAGCACTGATCAATGTGGG + Intronic
1089541262 11:119190317-119190339 GTGGCCTCAAAGATCCAGGGGGG + Exonic
1090770559 11:129915794-129915816 GTGGGAGCTCTGCTCCTGGGTGG + Exonic
1092422463 12:8343326-8343348 GTGGCAGCACTGGGCCAGGTGGG - Intergenic
1094333496 12:29322430-29322452 GATGCAGCACTGATGAAGGGAGG - Intronic
1095698333 12:45165289-45165311 CTGGGAGCTCTGTTCCAGGGAGG + Intergenic
1095921090 12:47532310-47532332 GTGGCAGCTGTGAACCAGGTGGG + Intergenic
1096475390 12:51906552-51906574 GTGTCAGCAGAGTTCCAGGGAGG + Intergenic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1100411299 12:94322296-94322318 TTGGGAGCTCTGTTCCAGGGAGG + Intronic
1102569627 12:113819510-113819532 GAGGGAGCACTCCTCCAGGGCGG - Intronic
1103876026 12:124127873-124127895 GTGTCAGCACTGGCCCCGGGAGG + Intronic
1104303005 12:127582523-127582545 GTGCCTGCTCTGATCAAGGGAGG - Intergenic
1104329550 12:127831685-127831707 GTGGCAGCAGGAATCCACGGAGG - Intergenic
1104661898 12:130617185-130617207 GTGGCAGCACTAACTCGGGGCGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1106723146 13:32456014-32456036 GTAGCAGCAGTGAACCAGGTAGG - Intronic
1107043459 13:35972647-35972669 GGGGCAGCACTGAGACAGAGTGG + Intronic
1107097261 13:36550088-36550110 GTGGCTGCACTGAGCCTGGGTGG + Intergenic
1107568118 13:41627639-41627661 GTGGGTGCACTGTTCCAGTGTGG - Intronic
1107903779 13:45043798-45043820 ATTGCAGCATTGATCCAGGCTGG + Intergenic
1110062160 13:71056006-71056028 GTGGCAGCAGTGGTCCAGGTGGG + Intergenic
1111090815 13:83444509-83444531 GTGGTAGGAGTGATCCAGGGTGG - Intergenic
1113869588 13:113550699-113550721 GTGGCAGCATTGATTCACGAGGG + Intronic
1113925622 13:113940021-113940043 GTGGCAGCCGTGATCAGGGGAGG + Intergenic
1114643319 14:24239306-24239328 GGGTCAGCACTGACCCAGTGGGG + Intergenic
1120863842 14:89278481-89278503 CTGGCAGAATTGAACCAGGGTGG - Intronic
1121684918 14:95828808-95828830 GTATCAGCTCTGATCCAGGCTGG + Intergenic
1121777813 14:96602287-96602309 GGCCCAGCACTGATGCAGGGAGG + Intergenic
1122179292 14:99943838-99943860 GTGGGAGCACTGTCCCAGAGAGG + Intergenic
1122357885 14:101134987-101135009 CTGGCAGCGCTGATCAAGGGAGG - Intergenic
1122523697 14:102364388-102364410 GTGCCAGCACTGTGCCAGGCTGG + Intronic
1123669443 15:22640347-22640369 GTTGCAGCACTGATCTAGTTTGG + Intergenic
1125507264 15:40274056-40274078 GTGGCAGCAGTGGTGGAGGGGGG - Intronic
1126999184 15:54481970-54481992 GTGGCAGCATTGCTCCTGTGAGG + Intronic
1128246415 15:66135682-66135704 GAGGCAGCCCTGATCAAGAGTGG - Intronic
1129985676 15:79918298-79918320 TAGGCAGCACTGAGCCGGGGTGG - Intronic
1132873586 16:2126072-2126094 GCAGCAGCACAGATCCAGCGGGG + Intronic
1132882001 16:2166496-2166518 GTGGCAGGACTGATCCCAGGAGG - Intronic
1133285785 16:4690109-4690131 GTGGCAGGACTGGCCCAGGGAGG + Exonic
1133375818 16:5286275-5286297 GTGGCAGTACTGGGCCAGGTGGG + Intergenic
1134552673 16:15145246-15145268 GCAGCAGCACAGATCCAGCGGGG + Intergenic
1135762542 16:25148741-25148763 GTGGCAGCGCTGAATCAGTGGGG + Intronic
1136366436 16:29811317-29811339 GCGGCAGCACAGATACAGGGCGG + Intronic
1139099175 16:63744564-63744586 GTGGCAGTGCTGGTGCAGGGCGG - Intergenic
1139696182 16:68676623-68676645 GTGTGAGCACTGATCTAAGGGGG + Intronic
1141156078 16:81597989-81598011 GTGACAGCTCTTATCCAGGGAGG + Intronic
1142357099 16:89606324-89606346 GTGTCAGCTCTGCTCCAGGAGGG + Intergenic
1142509021 17:383071-383093 ATGGGACCAGTGATCCAGGGAGG - Intronic
1142592254 17:1011455-1011477 GAGGCAGCACTGCCCCAGAGGGG + Intronic
1143415319 17:6743865-6743887 CTGGGAGCTCTGTTCCAGGGAGG - Intergenic
1144676617 17:17166228-17166250 CTGGGAGCACTGCTGCAGGGAGG - Intronic
1146930447 17:36773668-36773690 GTGGCAGGACTCAGCCAGGATGG - Intergenic
1148124987 17:45231835-45231857 ATGCCAGCTCTGGTCCAGGGAGG + Intronic
1148806607 17:50267069-50267091 GTGGCAGCACTGAACGAGTGGGG - Intergenic
1150512920 17:65775332-65775354 GAGGCAGCACTGATCTGGTGAGG - Intronic
1152134500 17:78495829-78495851 GTGGCTGCAGTGAGCCAGGCCGG - Intronic
1152238190 17:79149292-79149314 GTGGCTGCACCGGGCCAGGGAGG - Intronic
1153367180 18:4270171-4270193 GTGTCATCACTAATACAGGGTGG + Intronic
1153553412 18:6285247-6285269 GTGGCAGCACTGAAGGATGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1158544674 18:58386011-58386033 CAGGCAGCAGTGATCCAGGGAGG - Intronic
1158687950 18:59631770-59631792 GTGGCAGCTCTGCATCAGGGAGG + Intronic
1161678042 19:5664057-5664079 ATGGTAGCGCTCATCCAGGGCGG - Exonic
1162316048 19:9938633-9938655 GAGACAGGAATGATCCAGGGTGG - Intergenic
1162773543 19:12965176-12965198 GCGACTGCACTGATCCAGGTAGG + Intronic
1162897892 19:13776358-13776380 GTGGCTGCACTGGTCCCGGTGGG - Intronic
1163550633 19:17964724-17964746 GTGGCAGGACTGACTCAGGTGGG + Intronic
1165606778 19:37112635-37112657 TTGGAAGCACTGATCCAGCTAGG - Intronic
1166739263 19:45104260-45104282 TCTGCAGCACTGGTCCAGGGAGG - Intronic
1166867699 19:45850714-45850736 GTGACAACACTGCTCCAGGCAGG + Intronic
1167016331 19:46843270-46843292 GTGGCTGCAGTGGTCCAGGTGGG - Intronic
1167114885 19:47483415-47483437 GTGGCAGGAGGGATCCGGGGCGG + Intronic
928950077 2:36806519-36806541 GTGGAAGCAGTGACCCTGGGAGG - Intronic
929201674 2:39243671-39243693 GTGGCAGCACTGACCCGGTGAGG - Intergenic
929906293 2:46049307-46049329 AGGGCAGCACTAATCCAGTGAGG - Intronic
937212769 2:120287204-120287226 GAAGCATCACTGAGCCAGGGAGG + Intronic
937288574 2:120768287-120768309 GAGGAAGCACTGAGCCAGAGAGG + Intronic
937312130 2:120908971-120908993 ATGGCATCCCTGACCCAGGGTGG + Intronic
938063711 2:128270079-128270101 GTGGCAGCTCTGAAGCAGGCGGG + Intronic
938763933 2:134447963-134447985 GTGGCTGCAAAGACCCAGGGAGG + Intronic
938764301 2:134450147-134450169 ATGGCAGCAATGATTCAGTGGGG - Exonic
939086172 2:137721128-137721150 ATGGCAGCATTGATCGAGGAAGG - Intergenic
940382545 2:153032720-153032742 ATGACAGCACTGATCCAGAGAGG + Intergenic
942545777 2:177062284-177062306 GTGGGAGGACTGAGCCTGGGAGG - Intergenic
944544368 2:200784517-200784539 GAGGCAGCTTTGATCCAGGGTGG - Intergenic
1169021969 20:2336794-2336816 GTGTCACCACTGATCAATGGAGG - Intronic
1169140316 20:3224046-3224068 GGGGCAGCATGGATCCAGGGTGG - Intergenic
1169671411 20:8106604-8106626 AGGGCACCACAGATCCAGGGAGG - Intergenic
1169741303 20:8897743-8897765 GTGGCTGAACTGATCCTGGTTGG - Intronic
1170646711 20:18203058-18203080 GTGGCAGCAGTGGGCCAGGTGGG + Intergenic
1170885124 20:20334057-20334079 CTGGCAGCACTGGTGCTGGGAGG - Intronic
1171361736 20:24590734-24590756 GTGGAGGCACTGAACCATGGGGG + Intronic
1172007427 20:31826984-31827006 GTGACAGCACTGATCTCAGGGGG - Intronic
1172162790 20:32880031-32880053 CAGGCAGCAGTGCTCCAGGGTGG - Intronic
1173799156 20:45883951-45883973 GTTGCAGCACTGCACCAAGGAGG + Exonic
1175230544 20:57470927-57470949 GTGGCAGCACTGCTCCTGTCCGG + Intergenic
1175777863 20:61664243-61664265 GTGACAGCACAGCTCCAGGAGGG - Intronic
1177730668 21:25024319-25024341 GTGGCTGCAGTGAGCCAGGCAGG + Intergenic
1179821964 21:43942307-43942329 ATGGCACCACGGGTCCAGGGAGG + Intronic
1179949567 21:44702214-44702236 GTGGAAGCACTGGCTCAGGGAGG - Intronic
1180051878 21:45335266-45335288 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180051923 21:45335379-45335401 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180085552 21:45506536-45506558 GTGGCCGCTCTGATCCAGGTGGG + Intronic
1181587586 22:23862033-23862055 TTGGCAGCTCTGGTCCAGGGAGG + Intronic
1181822107 22:25484399-25484421 GTGCCCACACTGATCCAGGATGG - Intergenic
1183107924 22:35627931-35627953 GAGTCAGCTCTGCTCCAGGGAGG + Intronic
1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG + Intronic
1184334576 22:43845595-43845617 GTGGCAGCAGAGAGCCAGGGAGG - Intronic
1184422032 22:44387639-44387661 TTTGCAGCTCTGATTCAGGGTGG + Intergenic
1184508389 22:44917767-44917789 GTGGAAGGAGTGGTCCAGGGTGG + Intronic
1184582086 22:45424709-45424731 GTGGCAGTACTGCTCCTGGGAGG - Intronic
950197907 3:11022219-11022241 GTGTCAGCACAGTTCTAGGGCGG + Intronic
950335131 3:12187430-12187452 GTGGCAGTGATGGTCCAGGGGGG - Exonic
950670262 3:14521682-14521704 GTGGCTGCACTGCCGCAGGGTGG + Exonic
950866043 3:16190115-16190137 GTGGCAGCACAGAACCAAGTAGG - Intronic
952616439 3:35278708-35278730 CTGGAAGCTCTGTTCCAGGGCGG - Intergenic
953550410 3:43898200-43898222 GTGGCCACACTGAACAAGGGAGG - Intergenic
954372100 3:50174362-50174384 GGGGCAGCACAGGGCCAGGGTGG - Intronic
955137951 3:56238529-56238551 GTGGCAGCACTGATCTGCTGGGG - Intronic
956637643 3:71382208-71382230 GAGGCAGCACTGAGCCATGATGG + Intronic
956668631 3:71665074-71665096 GAGGCAGCCCTGATGCATGGTGG + Intergenic
957066254 3:75524919-75524941 GTGGCAACACTGGGCCAGGTGGG - Intergenic
959278922 3:104311873-104311895 GTGACAGCACTGCTTCAGAGAGG - Intergenic
960985137 3:123274186-123274208 TTGGCAGCAATGATACAGGTGGG - Intergenic
961286889 3:125813121-125813143 GTGGCAGCACTGGGCCAGGCGGG + Intergenic
961807698 3:129501096-129501118 GGGGCAGCACTGAGACAGGATGG + Intronic
962232354 3:133676625-133676647 GTGGCCGTGCTGAGCCAGGGAGG - Intergenic
968497792 4:927826-927848 GTGGCTGCGCTCACCCAGGGAGG - Intronic
969010867 4:4060999-4061021 GTGGCAGCACTGGGCCAGGTGGG - Intergenic
969743201 4:9048892-9048914 GTGGCAGCACTGGGCCAAGTGGG + Intergenic
969802581 4:9580986-9581008 GTGGCAGCACTGGACCAGGTGGG + Intergenic
972631124 4:40842878-40842900 GAGGCAGCACAGGTCAAGGGCGG + Intronic
974109756 4:57512016-57512038 GTGGGAGCTCTGTTCCAGCGAGG + Intergenic
978414018 4:108456848-108456870 GTGGCAGCAATGGTGGAGGGTGG - Intergenic
978683835 4:111415374-111415396 CTGGGAGCTCTGTTCCAGGGAGG + Intergenic
980447128 4:132923628-132923650 GTGGCAGTAGGGATCCAGAGAGG + Intergenic
982653501 4:158117691-158117713 GTGACTGCACTGCTCCATGGTGG + Intergenic
983178738 4:164622890-164622912 GGGACAGAACTGCTCCAGGGAGG + Intergenic
983507075 4:168565125-168565147 AAGGCAGCAGTGATCCTGGGAGG + Intronic
984164166 4:176287807-176287829 TTGGCAACACTGATACTGGGTGG - Intergenic
987875341 5:23674552-23674574 CTCCCAGCACTGCTCCAGGGAGG + Intergenic
988386249 5:30569229-30569251 GTGGGAGGATTGAGCCAGGGAGG - Intergenic
990370593 5:55114438-55114460 GTGGCAGCTCTGAACCTGGTGGG - Intronic
991408209 5:66321990-66322012 GTGGCAGCAAGGAACCAGGCAGG + Intergenic
992193735 5:74319029-74319051 TTGGTAGCACTGATTCCGGGGGG + Intergenic
994119921 5:96102101-96102123 GTGGCTGCCCTCCTCCAGGGAGG + Intergenic
996967499 5:129322633-129322655 GTGGCAGTAGTGGTCCAGGCAGG + Intergenic
997385037 5:133465703-133465725 GTGGCAGCACAGCTGCAGGTGGG + Intronic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
998119087 5:139561500-139561522 GAGGCGGCGCTGATCCTGGGAGG + Exonic
999251793 5:150186900-150186922 GTTGCAGCACTACTCTAGGGAGG + Intergenic
999821328 5:155231961-155231983 TGGGAAGCAGTGATCCAGGGAGG + Intergenic
1003995532 6:11537277-11537299 GGGGCAGCCCTGACCCAAGGTGG - Intergenic
1006406907 6:33850810-33850832 GTGGTAGCAGTGATCGGGGGCGG - Intergenic
1007114476 6:39333913-39333935 GTGGCTCCACTGATCCCAGGTGG + Exonic
1007756640 6:44103800-44103822 GTGGCAACACTGACCCAGGAGGG - Intergenic
1009374081 6:62946246-62946268 GTAGAAGCACTGATACGGGGAGG - Intergenic
1011117210 6:83906432-83906454 GTGATGGCACTGCTCCAGGGAGG - Intronic
1011648817 6:89486752-89486774 TTGACAGAACTGAACCAGGGTGG - Intronic
1016247118 6:141995360-141995382 GTGGCAGCAATGAGCCAAGTAGG - Intergenic
1018370411 6:163162921-163162943 AGGGCAGCACAGAGCCAGGGAGG + Intronic
1019436538 7:1025149-1025171 GAGGCAGCTCTGGGCCAGGGTGG + Intronic
1026940200 7:74283327-74283349 GTGGCAGGACTCAGTCAGGGAGG - Intergenic
1029070147 7:97889009-97889031 GTGGCAGCACTGGGCCAAGTGGG - Intergenic
1029698516 7:102230418-102230440 GAGGCAGCAGTGAGCCACGGTGG + Intronic
1032081383 7:128860147-128860169 CTGGGGGCACTGATCCAGGAGGG - Intergenic
1034753071 7:153588768-153588790 GTAGCAGCAATTATCCGGGGAGG + Intergenic
1035878395 8:3217117-3217139 ATGGCATCACTGCTCCAGGCTGG + Intronic
1036248408 8:7140678-7140700 GTGGCAGCACTGGGCCAGGTGGG + Intergenic
1036252401 8:7173659-7173681 GTGGCAGCACTGGGCCAGTTGGG - Intergenic
1036365093 8:8113801-8113823 GTGGCAGCACTGGGCCAGTTGGG + Intergenic
1036893451 8:12611365-12611387 GTGGCAGCACTGGGCCAGGTGGG - Intergenic
1040565794 8:48565573-48565595 GTGGCCGCACAGATGCAGGAGGG + Intergenic
1041550203 8:59091811-59091833 GTGGCAGCACTGACCTAGCATGG - Intronic
1041748738 8:61236578-61236600 GCAGCAGCACTGTTCCTGGGTGG + Intronic
1043549079 8:81348681-81348703 ATGGCAGGACTGATCCATGGTGG + Intergenic
1043751614 8:83943325-83943347 GTGGCAGCAGTGGGCCAGGTAGG + Intergenic
1050080318 9:1908978-1909000 GGGGCAGCACTCAACCAGTGGGG - Intergenic
1051201845 9:14634338-14634360 GTGGCAGCAATGCGCCAGGCAGG - Intronic
1052094710 9:24369940-24369962 CTGGGAGCTCTGATCCATGGAGG + Intergenic
1053066952 9:35075675-35075697 GCGGTAGCACTGATCCAGGCAGG - Exonic
1057190345 9:93083803-93083825 GTGGGAGCCGTGATCCAGGAAGG + Intronic
1057574229 9:96228720-96228742 ATGGCAGCTCTGTTCCAGGAAGG - Intergenic
1059749213 9:117232085-117232107 GTAGCAGCACTTACCCTGGGTGG - Intronic
1060817334 9:126642034-126642056 GTGGAAGAACTGTTCCAGGTGGG - Intronic
1061610574 9:131742763-131742785 ATGGATGCTCTGATCCAGGGTGG + Intergenic
1061647789 9:132019813-132019835 GGGCCAGCTCTCATCCAGGGGGG - Intronic
1062107352 9:134763217-134763239 GTTGAAGCAGTGAGCCAGGGAGG + Intronic
1191615089 X:63162243-63162265 GGGACAGAACTGCTCCAGGGAGG + Intergenic
1191621209 X:63216680-63216702 GGGACAGAACTGCTCCAGGGAGG - Intergenic
1191743827 X:64464537-64464559 CTGGGAGCTCTGATCCAGGGAGG + Intergenic
1192848726 X:74931302-74931324 TTGGCAGCACTGAGCAAGGTGGG + Intergenic
1193675497 X:84447549-84447571 GTGACAGCATTGCTCCAGAGAGG + Intronic
1194781517 X:98029634-98029656 GTGGGAGCTCTGTCCCAGGGAGG + Intergenic
1195552126 X:106182717-106182739 GTGGGGGCACTGCTGCAGGGGGG + Intronic
1195736654 X:108019025-108019047 GTGGCAGCAGTGGGCCAGGCAGG + Intergenic
1197009619 X:121545219-121545241 GTTGGAGTAATGATCCAGGGAGG - Intergenic
1199762117 X:150912950-150912972 GTGGCGGCAATGAAGCAGGGAGG - Intergenic
1202042358 Y:20698450-20698472 CTGCCACCACTGAACCAGGGAGG - Intergenic