ID: 1184186948

View in Genome Browser
Species Human (GRCh38)
Location 22:42871349-42871371
Sequence GAGGCGATCCAGTGATGAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184186948_1184186949 -8 Left 1184186948 22:42871349-42871371 CCGACTCATCACTGGATCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1184186949 22:42871364-42871386 ATCGCCTCCACATAATTTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 59
1184186948_1184186953 -1 Left 1184186948 22:42871349-42871371 CCGACTCATCACTGGATCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1184186953 22:42871371-42871393 CCACATAATTTGCCGGGTATAGG 0: 1
1: 0
2: 1
3: 5
4: 59
1184186948_1184186950 -7 Left 1184186948 22:42871349-42871371 CCGACTCATCACTGGATCGCCTC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1184186950 22:42871365-42871387 TCGCCTCCACATAATTTGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184186948 Original CRISPR GAGGCGATCCAGTGATGAGT CGG (reversed) Exonic
906567853 1:46813428-46813450 GAGGCGATGCAGGGGTTAGTTGG - Intronic
912182064 1:107231281-107231303 GAAGCGATCCAGTACTGAGTGGG - Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
922011868 1:221596863-221596885 GAGGAGATCAACTGATCAGTTGG - Intergenic
1066168196 10:32811600-32811622 GAGGCCATCTAGTCATGTGTTGG - Intronic
1074901304 10:117818474-117818496 GAGGAGAGCCAGGGATGAGGAGG - Intergenic
1081063152 11:38504757-38504779 GAGGCTATCTAGGGATAAGTGGG - Intergenic
1091070438 11:132558055-132558077 GAGGAGATGCATTGAAGAGTGGG + Intronic
1097246969 12:57612006-57612028 GAGAGGGTCCAGTGTTGAGTGGG + Intronic
1100565949 12:95793703-95793725 GAGGCAATCCAGTAATGAGAAGG + Intergenic
1102987896 12:117293398-117293420 GGGGAGAGTCAGTGATGAGTTGG - Intronic
1103307516 12:119977270-119977292 GAGGCTATCATGTGATAAGTTGG - Intergenic
1106154897 13:27145125-27145147 GAGGAGGTTCAGTGAAGAGTGGG - Intronic
1115313476 14:32003125-32003147 GAGGCTAAGCAGTGATGACTGGG - Intergenic
1116861589 14:50000149-50000171 GAGGGGATTCAGTTAGGAGTCGG - Intronic
1125159691 15:36628623-36628645 GAGTTGATTCTGTGATGAGTTGG + Intronic
1133848883 16:9483241-9483263 GTTGAGATCCAGTGATGAGAAGG + Intergenic
1133982645 16:10644913-10644935 GAGGCGATTAGGTGATGAGGTGG + Intronic
1134245258 16:12534919-12534941 GAGGCCATCCTGTGAGGTGTAGG - Intronic
1136778676 16:32884538-32884560 GAAGTGACCCAGTGATGGGTGGG - Intergenic
1136891944 16:33976976-33976998 GAAGTGACCCAGTGATGGGTGGG + Intergenic
1203081092 16_KI270728v1_random:1146632-1146654 GAAGTGACCCAGTGATGGGTGGG - Intergenic
1157806211 18:50659541-50659563 GAGGCAAACCAGAGATGAGATGG - Intronic
1161032568 19:2064967-2064989 GATCCCATCCAGTGATGCGTAGG + Intergenic
1161214461 19:3086701-3086723 GAGGAGATCCAGTGGGGAGCAGG - Intergenic
1168441186 19:56368491-56368513 GAGGCGCTCCGGGGAGGAGTGGG + Intergenic
927419684 2:22917172-22917194 GAGGATATTCAGTGAGGAGTTGG - Intergenic
935375212 2:102388547-102388569 GAGGTGATCCGGTGGTGAGCAGG - Intronic
937576517 2:123429020-123429042 GTGCCCATCCAGTGAAGAGTTGG - Intergenic
939771299 2:146322653-146322675 GAAGTGATGCAGTGATGTGTTGG + Intergenic
945373549 2:209051778-209051800 GTGGGGCTCCAGTGCTGAGTAGG - Intergenic
1169054751 20:2611387-2611409 GAGGGAAGCCAGAGATGAGTGGG - Intronic
1175331203 20:58165723-58165745 GAGGAGTTGCAGGGATGAGTGGG - Intergenic
1175760166 20:61557016-61557038 GAGGTCATCCCTTGATGAGTTGG + Intronic
1184186948 22:42871349-42871371 GAGGCGATCCAGTGATGAGTCGG - Exonic
1184502673 22:44883236-44883258 CAGGCGGTCCAGGGATGACTGGG + Exonic
949922173 3:9011530-9011552 GAGCCAACCCAGTGAGGAGTGGG - Intronic
950190588 3:10973730-10973752 GTGGCGATTCAGTGATTATTAGG - Intergenic
950721069 3:14882968-14882990 AAGGCTGTCCAGTGATGAGGAGG + Intronic
951507907 3:23469164-23469186 GAGAGGATCCAGTGATAAGTTGG - Intronic
962829006 3:139123406-139123428 GAGGCTCTCCAGGGATGTGTGGG - Intronic
962998656 3:140655863-140655885 GAGGGGATCCCCTGATCAGTGGG - Intergenic
963982465 3:151554871-151554893 GAGGCTATCCAGAGATCTGTGGG + Intergenic
964391667 3:156204275-156204297 AAGGCCATGCAGCGATGAGTAGG - Intronic
967845511 3:194039512-194039534 GAGGGTTTCCAGTGATGTGTAGG - Intergenic
970466514 4:16329087-16329109 GAGTTTATCCAGTGAAGAGTTGG + Intergenic
974081453 4:57217527-57217549 GAGGAGATCCAGTAATCAGATGG - Intergenic
976361928 4:84189993-84190015 AAGGAGATAAAGTGATGAGTTGG + Intergenic
977228335 4:94421389-94421411 GAGGTGATACAGTGATGAATGGG + Intergenic
988555892 5:32235779-32235801 GAGGCGAGCCCTTGATGAGCAGG + Intronic
990254655 5:53954462-53954484 CAGGTGATCCAGTGAGGAATTGG - Intronic
991645145 5:68794077-68794099 GAGGAGATCCATGTATGAGTAGG + Intergenic
1005156158 6:22809081-22809103 GAAGTTATACAGTGATGAGTGGG + Intergenic
1006745903 6:36341894-36341916 GAGGCGATGCAGTGAGCACTTGG + Intergenic
1007315352 6:40983842-40983864 GAGGAGATGCAGTGATGAGAAGG - Intergenic
1010593774 6:77740327-77740349 CATTTGATCCAGTGATGAGTTGG + Intronic
1016668199 6:146669237-146669259 GTGGAGATCCAGGGATGAATAGG + Intronic
1023541357 7:41270174-41270196 GAGGCAATTCAGAGATGAGGAGG - Intergenic
1028494070 7:91444672-91444694 GAGGCTTTGGAGTGATGAGTGGG + Intergenic
1034974986 7:155443057-155443079 GAGGCCACCCAGTGATGACATGG + Intergenic
1044424941 8:92039797-92039819 GAGGGGCTCCAATGATCAGTTGG - Intronic
1049381863 8:142320140-142320162 GAGGGGATGCAGTGGTGAGTGGG - Intronic
1055359880 9:75478174-75478196 CAGGCAATCCAATGCTGAGTTGG - Intergenic
1185717473 X:2354281-2354303 ACGGCCATCCAGTGATGACTTGG - Intronic
1189369901 X:40419405-40419427 GAGACCACCCAGTGGTGAGTGGG + Intergenic
1200245215 X:154520073-154520095 GAGGCAATGCAGTTATGTGTTGG - Intergenic