ID: 1184187795

View in Genome Browser
Species Human (GRCh38)
Location 22:42876390-42876412
Sequence GCCCTCCCCTTGCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 167}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184187795_1184187805 -8 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187805 22:42876405-42876427 GGGAGGGCACTGGAGCCTTGGGG 0: 1
1: 0
2: 4
3: 33
4: 402
1184187795_1184187808 5 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187808 22:42876418-42876440 AGCCTTGGGGCTCAGGGCTGAGG 0: 1
1: 0
2: 7
3: 67
4: 704
1184187795_1184187806 -2 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187806 22:42876411-42876433 GCACTGGAGCCTTGGGGCTCAGG 0: 1
1: 0
2: 0
3: 26
4: 319
1184187795_1184187811 19 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187811 22:42876432-42876454 GGGCTGAGGGCTCCTTCCGAAGG 0: 1
1: 0
2: 0
3: 16
4: 135
1184187795_1184187803 -10 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187803 22:42876403-42876425 AGGGGAGGGCACTGGAGCCTTGG 0: 1
1: 3
2: 8
3: 57
4: 688
1184187795_1184187813 30 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187813 22:42876443-42876465 TCCTTCCGAAGGAGCACAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 97
1184187795_1184187804 -9 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187804 22:42876404-42876426 GGGGAGGGCACTGGAGCCTTGGG 0: 1
1: 1
2: 8
3: 45
4: 406
1184187795_1184187807 -1 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187807 22:42876412-42876434 CACTGGAGCCTTGGGGCTCAGGG 0: 1
1: 0
2: 7
3: 155
4: 2166
1184187795_1184187809 6 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187809 22:42876419-42876441 GCCTTGGGGCTCAGGGCTGAGGG 0: 1
1: 0
2: 3
3: 50
4: 426
1184187795_1184187812 27 Left 1184187795 22:42876390-42876412 CCCCCGCCCCGCAAGGGGAGGGC 0: 1
1: 0
2: 3
3: 13
4: 167
Right 1184187812 22:42876440-42876462 GGCTCCTTCCGAAGGAGCACAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184187795 Original CRISPR GCCCTCCCCTTGCGGGGCGG GGG (reversed) Intronic