ID: 1184190166

View in Genome Browser
Species Human (GRCh38)
Location 22:42889224-42889246
Sequence GGAGGGGTTATGGGCATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184190166 Original CRISPR GGAGGGGTTATGGGCATCCC AGG Intronic
900172173 1:1274382-1274404 GGGGAGGTCAGGGGCATCCCGGG - Intergenic
901157535 1:7150472-7150494 GCAGGTGTTATGGACATTCCAGG + Intronic
902220009 1:14958769-14958791 GGAGGGGCCAAGGGCAGCCCTGG - Intronic
902220154 1:14959462-14959484 GGAGGGGACAAGGGCAGCCCTGG - Intronic
902809027 1:18877830-18877852 GGAGGGGTGAAGGGCATCAGAGG + Intronic
903436931 1:23356988-23357010 GGAGGTGGTATGGGCATGACTGG + Intergenic
903668513 1:25022263-25022285 TGAGGGGTTATGAGGACCCCTGG + Intergenic
905732785 1:40307857-40307879 GGAGTGGCTCTGGTCATCCCAGG + Intronic
906298968 1:44667813-44667835 GAGGGGCTTCTGGGCATCCCTGG - Intronic
906746940 1:48228670-48228692 GGAGGGGTATTAGTCATCCCAGG - Intronic
907547750 1:55277032-55277054 GGAGTGGTTATGGGAATCTAGGG - Intergenic
910254163 1:85230534-85230556 GGTGGGTTGATGGGCAGCCCTGG - Intergenic
914341470 1:146763892-146763914 GGAGGGGTCATGGGGAAGCCGGG + Intergenic
918235877 1:182580479-182580501 GGATGTGTGCTGGGCATCCCAGG - Intronic
920412053 1:205769833-205769855 GGAGGGGGTCTGGGCATCTGTGG - Exonic
922749103 1:228062483-228062505 GGAGGGGTTATGCTCCTGCCTGG - Intergenic
923520980 1:234734743-234734765 GGAGGGGTGAGGGGCAGCTCAGG + Intergenic
924134343 1:240947978-240948000 GGAAGGGTTCTGAGCATTCCAGG - Intronic
1063155701 10:3377320-3377342 GGATAGATTATGGGCATCCATGG - Intergenic
1063918004 10:10903949-10903971 TGATGAGTTAAGGGCATCCCTGG + Intergenic
1066065706 10:31759721-31759743 GAAAGGGGTCTGGGCATCCCAGG + Intergenic
1067084514 10:43230719-43230741 GGTGAGGGTATGGGCATCCTGGG - Intronic
1068116095 10:52739472-52739494 GGGGGGGTTGTGGGCTGCCCTGG + Intergenic
1069893259 10:71665091-71665113 GGATGGGTGCTGGGGATCCCTGG + Intronic
1070783199 10:79149199-79149221 GGAGGGGGTGTGGGCCTGCCTGG - Intronic
1071516019 10:86298508-86298530 TGTGGGGCTATGGGCAGCCCTGG + Intronic
1073075492 10:100823643-100823665 GGAGGGGTTAAGGGGGTTCCAGG + Intronic
1076502354 10:130947273-130947295 GGAAAAGTTATGGTCATCCCGGG - Intergenic
1078631140 11:13005760-13005782 GGAGGGGTTGAGGGCATTCTTGG - Intergenic
1080319588 11:30991094-30991116 GGAGGGCTAAGGGACATCCCTGG + Intronic
1084480591 11:69417675-69417697 GAAGGGGCTCTGGGCAGCCCTGG + Intergenic
1084569894 11:69953092-69953114 GTAAGGGTTCTGGGCTTCCCTGG - Intergenic
1084703097 11:70800354-70800376 GAAGGTGTTGAGGGCATCCCTGG - Intronic
1089640361 11:119843796-119843818 GGAGGGGGAAAGGGCAGCCCAGG + Intergenic
1090380700 11:126325789-126325811 TGAGGGTTTATGGTTATCCCAGG + Intronic
1096190740 12:49616908-49616930 GGAGGGATTGTGGGCAACCAGGG + Intronic
1101305009 12:103519708-103519730 GGAGGGGTGAGGGGCTTCCTAGG - Intergenic
1102068728 12:109999877-109999899 GGAAGGGGTCTGGGGATCCCGGG - Intronic
1102515232 12:113441808-113441830 GGAGGTGTTAGGGTCATCCTGGG - Intergenic
1102549050 12:113677768-113677790 GGTGGGGTGAAGGGCATCCCAGG + Intergenic
1102586943 12:113930299-113930321 TGAGGGGTTCTGGGCTCCCCGGG - Intronic
1107570348 13:41650883-41650905 GGAGTGTGTATGGGCATTCCAGG + Intronic
1109439308 13:62349151-62349173 GGAGGGGTGATGGCCCACCCTGG + Intergenic
1110416345 13:75257582-75257604 AGAGAGATTATGAGCATCCCAGG + Intergenic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1113586988 13:111472350-111472372 GCAAGGGTGAGGGGCATCCCGGG + Intergenic
1118642808 14:67807942-67807964 GGATGGGTGGTGGGCATGCCTGG + Intronic
1121544042 14:94750699-94750721 GGAGGGATTGGGGGCAGCCCTGG - Intergenic
1121714032 14:96060019-96060041 GGAGGGGAGGGGGGCATCCCAGG - Intronic
1122082911 14:99279050-99279072 AGAGGTGTCATGGGCCTCCCTGG + Intergenic
1122771637 14:104100288-104100310 GGAGGGGCTCTGGGCATGTCTGG + Intronic
1122902014 14:104785924-104785946 GGTGGGGTACTGGGCCTCCCTGG + Intronic
1126907587 15:53384510-53384532 GGAGCATTTATGGGCTTCCCAGG + Intergenic
1128512021 15:68319222-68319244 GGAGGGGTTAAGGCCTGCCCAGG - Intronic
1129739976 15:77985409-77985431 GGAGGGAGTCTGGGCATTCCAGG + Intronic
1129762610 15:78139320-78139342 GGAAGGGTTAAGGGATTCCCAGG - Intronic
1130805152 15:87313291-87313313 GGAGAGGTAAAGGGCAACCCAGG + Intergenic
1132208233 15:100001197-100001219 TCAGGGGTAATGGGCATGCCTGG - Intronic
1132690632 16:1180495-1180517 GGAGGGGGTATGGGGACGCCAGG - Intronic
1132866256 16:2094054-2094076 GGAGGGGCTAGGGGCATCCCGGG + Intronic
1134112637 16:11524723-11524745 GGAGGGGTGCTGGCCTTCCCAGG - Intergenic
1134859571 16:17549027-17549049 GGAGGGGTTGTGGGCAGGCGTGG + Intergenic
1135635481 16:24071901-24071923 GGAGGGGTCGTCGGCATCACTGG + Intronic
1136397304 16:30000269-30000291 GGAGAGGCTATGGGCCTCCCTGG + Intronic
1137614085 16:49836726-49836748 GGAGGGGATAAGGGCATTCATGG - Intronic
1139992811 16:70953550-70953572 GGAGGGGTCATGGGGAAGCCGGG - Intronic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1142144524 16:88487379-88487401 GGAGGGGATGTGGCCATACCCGG + Intronic
1144179478 17:12738309-12738331 GGAGAGATCATGGGCAGCCCTGG + Intronic
1147661789 17:42120918-42120940 GGCGGGGCTTGGGGCATCCCAGG - Intronic
1148200254 17:45745517-45745539 GGGGGGATTTGGGGCATCCCAGG + Intergenic
1148489736 17:48015259-48015281 GGAGGGGATTGGGGTATCCCAGG - Intergenic
1152206485 17:78977181-78977203 GGAGGGGTCATGGCCGTGCCTGG + Exonic
1154500568 18:14994704-14994726 AGAGGGGTCATAGGTATCCCTGG + Intergenic
1157622418 18:49024114-49024136 GGAGGGCTGATGGGGAACCCTGG + Intergenic
1157627298 18:49061319-49061341 GGTGGGGGGAAGGGCATCCCAGG + Intronic
1159778889 18:72638022-72638044 GGAGGGGTTGTGGAAATCGCAGG + Intronic
1160227211 18:77020413-77020435 GGAGGGGTCACGGGGACCCCAGG - Intronic
1161021699 19:2014258-2014280 GGAGGGGTCCTGAGGATCCCCGG + Intronic
1161297177 19:3526026-3526048 GGAGGGGCCCTGGGCTTCCCGGG - Intronic
1163628473 19:18404140-18404162 TGAGGTTTTCTGGGCATCCCTGG - Intergenic
1166557908 19:43713643-43713665 GGAGCTGCTAGGGGCATCCCTGG + Intergenic
1166853883 19:45772900-45772922 GGAGGGGCTATTGGCCTACCTGG - Intronic
926615713 2:14994909-14994931 GATGGGGTTTTGGGCATCACTGG - Intergenic
928333034 2:30372248-30372270 GGATGGGTTCTGGGAAGCCCTGG - Intergenic
936483558 2:112907301-112907323 GGAGGGCTTATAGGATTCCCAGG + Intergenic
937262543 2:120595742-120595764 GAATGGTTTCTGGGCATCCCTGG - Intergenic
938379247 2:130827370-130827392 GGAAGGGTTGTGGGCGTGCCAGG - Intergenic
938499771 2:131825032-131825054 AGAGGGGTCATAGGTATCCCTGG + Intergenic
939153992 2:138502340-138502362 GGAGGGATTGGGGGCAACCCCGG - Intronic
940723593 2:157309069-157309091 GGAGAGGATATGGGCAACACAGG + Intronic
942104489 2:172619281-172619303 GGAGAGAATGTGGGCATCCCTGG - Intergenic
948019291 2:234716716-234716738 GGAGGGGTTATGGGAAATGCAGG - Intergenic
948491236 2:238314702-238314724 GGAGGGCGGATGGGCATCCGGGG - Intergenic
948523898 2:238558749-238558771 GGAGGTGGGATGGGCTTCCCTGG - Intergenic
948918365 2:241049862-241049884 GGAGTCGTCATGGGCATCGCAGG - Exonic
1168960602 20:1866850-1866872 GGAGGTTTTATGGGCAGGCCTGG - Intergenic
1169046172 20:2536233-2536255 GGAGGTGTGAGGAGCATCCCAGG - Intergenic
1169339334 20:4784240-4784262 CGAGGGGATCTGGGCACCCCAGG - Exonic
1172007117 20:31825099-31825121 AGTGAGGTTCTGGGCATCCCAGG + Intronic
1172578546 20:36028659-36028681 GGAGGGCTTAAGGGCGTCACGGG + Intronic
1173422989 20:42919135-42919157 GGAGGGGTGATGGGTGTCCCTGG - Intronic
1174191796 20:48745901-48745923 GGAAGGGTTAACAGCATCCCTGG - Intronic
1175937930 20:62523474-62523496 GGAGGGGTTGGGGGCAGACCTGG + Intergenic
1181306854 22:21921896-21921918 AGCGGGGCTCTGGGCATCCCGGG - Exonic
1181434887 22:22904934-22904956 GCTGGGGCTAGGGGCATCCCAGG + Intergenic
1181671668 22:24428154-24428176 GGAAGGGGTATGGGGATCCTGGG + Intronic
1182697038 22:32204745-32204767 GGAGGGGTTCTTGCCATTCCAGG - Intergenic
1182698516 22:32212223-32212245 GCTGGGGGTAGGGGCATCCCAGG + Intergenic
1183239503 22:36646744-36646766 GGTGGGGTTGTGGGGAGCCCAGG - Intronic
1184190166 22:42889224-42889246 GGAGGGGTTATGGGCATCCCAGG + Intronic
1184475827 22:44720777-44720799 GCAGGGGTGAGGGGCATCACTGG - Intronic
1184527414 22:45033389-45033411 GAGGGGTTGATGGGCATCCCAGG + Intergenic
1184648809 22:45910303-45910325 GAAGGGATTAGGGGCATCCTTGG + Intergenic
1185082605 22:48718212-48718234 GAAGTGGCCATGGGCATCCCAGG - Intronic
1185172759 22:49303327-49303349 GGAGGAGTGATGAGCTTCCCAGG - Intergenic
949483494 3:4515434-4515456 GGAGGGGTTTTGGGAAAACCTGG + Intronic
950189581 3:10967236-10967258 GGAGGGGTGAAGGGCATTGCAGG + Intergenic
950865189 3:16183123-16183145 GGAGGGGTTCAGGGGATCCTTGG - Intronic
952265908 3:31786077-31786099 GGAGGGAATAATGGCATCCCTGG - Intronic
953576002 3:44113686-44113708 GGAGGGGTGAGGGGCAGCCGAGG + Intergenic
954363502 3:50134562-50134584 GGAGGGGTTACTGGGACCCCTGG + Intergenic
954750350 3:52810066-52810088 GGAGGGGGTAAGGGCATGCTGGG + Intergenic
955083924 3:55683829-55683851 GGAGGGCATATGGGCATAGCCGG - Exonic
956701464 3:71962844-71962866 GGAGGTGGCATGGGCTTCCCGGG - Intergenic
957427038 3:80051847-80051869 GGAGGGTTTATGGGCCTCAGAGG - Intergenic
959987059 3:112585607-112585629 GGAGGTCTTATGGGCACCACTGG + Intergenic
960621114 3:119637754-119637776 GGAGTTGTGATGGTCATCCCAGG - Intronic
961721141 3:128897020-128897042 GGATGAGTTCTGGGCACCCCAGG - Intronic
968584846 4:1411517-1411539 GGAGGGAATGTGGCCATCCCAGG - Intergenic
969487064 4:7478279-7478301 TCAGGGGCTATGGGCAGCCCAGG + Intronic
986307384 5:6525678-6525700 GGAGGGGACTTGGGGATCCCTGG - Intergenic
986556317 5:9013256-9013278 GGAATGGCTATGGGCATCTCTGG + Intergenic
990124117 5:52493572-52493594 GAAGTGGATATGGGCATCCCAGG + Intergenic
994857097 5:105136327-105136349 GGAGGGGGGCTGTGCATCCCTGG - Intergenic
997251126 5:132389457-132389479 GGACCGTTTATGGACATCCCAGG - Intronic
997387977 5:133488830-133488852 GGAGGGGTGAGGGGCATCATGGG - Intronic
1004326160 6:14675756-14675778 GGAGGGGTTGTTGGCAGGCCTGG - Intergenic
1005643732 6:27821663-27821685 GAAGGGGTAGTGGGAATCCCTGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007687757 6:43677170-43677192 AGTGGGGTTGTGGGCATCCTTGG - Intronic
1009289961 6:61869107-61869129 GGCAGGGTGATGGGCTTCCCAGG - Intronic
1011701473 6:89959189-89959211 GGAGGGGGTGATGGCATCCCAGG + Intronic
1013780657 6:113725359-113725381 GAAGGGGTTTTGTGCTTCCCAGG - Intergenic
1014815795 6:125934084-125934106 GAAGGGCTAGTGGGCATCCCAGG - Intergenic
1017133163 6:151125314-151125336 AGAGGGGTCATAGGTATCCCTGG + Intergenic
1019408378 7:895728-895750 GGAGGGCTGATGGGCAGCACAGG + Exonic
1019649821 7:2150743-2150765 GGAGGGCTTATGACCAGCCCTGG - Intronic
1019895918 7:3982942-3982964 GGAGGGGTTCAAGGCATCCACGG + Intronic
1022420923 7:30222769-30222791 CCTGGGGTTCTGGGCATCCCTGG - Intergenic
1022589737 7:31650311-31650333 GGGGAGGTTAAGGTCATCCCAGG + Intronic
1023938947 7:44757941-44757963 GGAGGGGTAATGGGCCCCTCTGG + Exonic
1033042268 7:137929209-137929231 ACAGGGGATATGGGAATCCCGGG - Intronic
1036692350 8:10951861-10951883 GGAGCTGTTATGGGGATGCCAGG + Intronic
1038391062 8:27201471-27201493 GGAAGGATTATGGGCATTCCAGG - Intergenic
1039236690 8:35509841-35509863 GGAGGGGTTGTGAGAACCCCAGG - Intronic
1040915617 8:52564633-52564655 GGAGGGGAAAGGGGCATTCCTGG + Intronic
1043363278 8:79500147-79500169 GGGGGGGTGATGGCCCTCCCGGG - Intergenic
1045228226 8:100273003-100273025 GGCGTGGTGATGGGCATCTCTGG - Intronic
1049621639 8:143600893-143600915 TGAGGAGGCATGGGCATCCCTGG - Exonic
1051149421 9:14064247-14064269 AGAGGGGTTATGGGCATTTCAGG - Intergenic
1051170049 9:14313130-14313152 AGAGGGGCTACGGGCACCCCGGG + Intronic
1051255076 9:15204838-15204860 GGTGGGGCTCTGTGCATCCCAGG + Intronic
1051257142 9:15225890-15225912 GGAAGGGTTGTGGGCATTCCTGG - Intronic
1055021492 9:71675273-71675295 GGAGGGGTGATTGGCACCCCTGG + Intergenic
1055325536 9:75124415-75124437 GGAAGGGTAATGGGCAAACCTGG - Intronic
1057801092 9:98192071-98192093 GGTGGGGTGGGGGGCATCCCCGG - Intronic
1057915729 9:99053751-99053773 GGAGGGAATATGAGCATCACAGG - Intronic
1060199646 9:121645150-121645172 GGAGGGGCTGTGGGCGTCACTGG + Intronic
1060277107 9:122190810-122190832 GGAGTGGTGATGGGGATGCCTGG + Intronic
1060779677 9:126402186-126402208 AGAGGGGTTCTGTGTATCCCAGG + Intronic
1060964984 9:127707301-127707323 GGATGGGGTCTGGACATCCCAGG - Intronic
1061245766 9:129400745-129400767 GGAGGGGTGAAGGTCATCCCAGG + Intergenic
1061258484 9:129466407-129466429 GGAGGGGTCATGGGGAGCCATGG + Intergenic
1061429829 9:130523934-130523956 GGAGGCTTTATCTGCATCCCAGG + Intergenic
1062056853 9:134473215-134473237 GGAGGGGGACTGGGCCTCCCAGG - Intergenic
1186299276 X:8181567-8181589 GGTGGGGTTCTGGGCATTGCAGG + Intergenic
1187727481 X:22218360-22218382 GGAGGGGCTATGTGCATTCAGGG + Intronic
1192670908 X:73140238-73140260 GGATGGGTTAAGGGGATCACAGG - Intergenic
1193635443 X:83944249-83944271 CCTGGGTTTATGGGCATCCCTGG + Intergenic
1197596301 X:128468319-128468341 GGAGGGGTTAGGGGCATAGTGGG - Intergenic