ID: 1184191088

View in Genome Browser
Species Human (GRCh38)
Location 22:42895001-42895023
Sequence ACCAGGATTCTGGTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191088_1184191092 0 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191092 22:42895024-42895046 GAAAAGCAAAGACCCCTGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 314
1184191088_1184191093 3 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191093 22:42895027-42895049 AAGCAAAGACCCCTGGAAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 297
1184191088_1184191097 13 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191097 22:42895037-42895059 CCCTGGAAGGTGGTTAGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 234
1184191088_1184191099 29 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191099 22:42895053-42895075 GCCTGGGCAGCCTTCTCCAGAGG 0: 1
1: 0
2: 2
3: 47
4: 293
1184191088_1184191095 12 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191095 22:42895036-42895058 CCCCTGGAAGGTGGTTAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 189
1184191088_1184191091 -4 Left 1184191088 22:42895001-42895023 CCTGTGAGAACCAGAATCCTGGT 0: 1
1: 0
2: 2
3: 14
4: 178
Right 1184191091 22:42895020-42895042 TGGTGAAAAGCAAAGACCCCTGG 0: 1
1: 1
2: 2
3: 22
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191088 Original CRISPR ACCAGGATTCTGGTTCTCAC AGG (reversed) Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
900733097 1:4275859-4275881 ACCAGGATTCTGGGTGTGAGGGG + Intergenic
901448085 1:9320107-9320129 TCCAGGCGTCTGCTTCTCACCGG + Intronic
901713305 1:11133039-11133061 GCCAGGGTGCTGGGTCTCACAGG + Intronic
904424616 1:30415443-30415465 GGGAGGATGCTGGTTCTCACGGG - Intergenic
906697609 1:47834029-47834051 GCCAGGCTGCTGGTTTTCACTGG - Intronic
906963221 1:50432115-50432137 GCCAGAATTCTGGTTCTGAAGGG - Intergenic
907318721 1:53589379-53589401 CCCAGGATTTTGTTTCTCAGGGG + Intronic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
912584125 1:110746411-110746433 ACCTGGATTATGGTTTACACTGG - Intergenic
915841907 1:159220151-159220173 ACCAGGAAACTGGACCTCACCGG - Intergenic
917315786 1:173723923-173723945 AGAAAGATTCTGGATCTCACAGG - Intronic
921456606 1:215379657-215379679 ACCAGGCTTCTGGTACTGCCAGG - Intergenic
922480428 1:225936896-225936918 ACCTGGATTCTGGTTCTGACAGG - Exonic
923685571 1:236151097-236151119 ACCAGCTTTCTTCTTCTCACTGG - Intronic
1063276823 10:4578399-4578421 ACCAGGAAGCCGGTCCTCACTGG - Intergenic
1064018534 10:11791419-11791441 ACCTGGATTCTGGTTCTACGTGG - Intergenic
1064160002 10:12937182-12937204 ACCCTGATACTGGTTCCCACAGG + Intronic
1067980564 10:51079592-51079614 ACCAAGATTCTCATTCTCACTGG - Intronic
1068054404 10:51993581-51993603 GCCAGGATTCTGGCTCTCACTGG + Intronic
1070409275 10:76124555-76124577 ACCAGGATTCTTTTTATCAAAGG - Intronic
1071953291 10:90729088-90729110 ACTGGGATTCTGTTTCTTACAGG - Intergenic
1074358204 10:112804270-112804292 GCCAGGCTTCTGGTTCCCACAGG - Intronic
1075674557 10:124287369-124287391 TCCCTGATTCTGGTACTCACTGG + Intergenic
1076098722 10:127756377-127756399 ACCAGGATTCTTATGCTCTCTGG - Intergenic
1080535960 11:33221860-33221882 ACCAAGAATCTGGTTGTCTCAGG - Intergenic
1080962861 11:37180641-37180663 CCCAGGATGCTGCTTCTCCCTGG - Intergenic
1084302266 11:68259435-68259457 CCCAGGGTTCTGGCTCTCCCAGG + Intergenic
1086411939 11:86552422-86552444 AGCAGGATTCTTGCTCACACTGG - Intronic
1088890559 11:114040990-114041012 ACTAGGATCCAGGTTGTCACGGG + Intergenic
1091011994 11:132009831-132009853 ATCATGATGCTGGTTCTCAGAGG + Intronic
1091561357 12:1616457-1616479 ACCAGGTTTGTGGGTCTCACAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092070446 12:5627323-5627345 ACCAGGATCCTGGCTCTCTGGGG - Intronic
1096423268 12:51478798-51478820 ATCAGGATTCTGGTTGTGACTGG + Intronic
1098448539 12:70592807-70592829 GCCTGGATTCTGGTTCAGACTGG + Intronic
1102229431 12:111252360-111252382 ACCTGGGTTCTGGTTTTAACTGG - Intronic
1103973172 12:124685134-124685156 AACAATATTCTGGTTTTCACTGG - Intergenic
1106370670 13:29129745-29129767 CCCAGCATGCTGGTTCTCAGGGG + Intronic
1109166123 13:59037845-59037867 CCCAAGAGACTGGTTCTCACAGG + Intergenic
1110273179 13:73614170-73614192 GCCAAGATTCTTGTTCTCATGGG + Intergenic
1112115430 13:96347004-96347026 TGCAGGATTCGGCTTCTCACTGG - Intronic
1112185163 13:97120981-97121003 ACTGGGATTCTGATTCTCTCTGG - Intergenic
1112414749 13:99194997-99195019 AGCAGGATTCTTGCTCACACTGG - Intergenic
1113067638 13:106388083-106388105 ACCAGGATTCTGGTTTTCCTAGG + Intergenic
1113108186 13:106793456-106793478 TCCAGGAATCTGCATCTCACAGG + Intergenic
1115732978 14:36291836-36291858 TTCAGGATTGTGATTCTCACTGG + Intergenic
1115815389 14:37158654-37158676 ACCAGTGTTCTGGTTCTTAGAGG - Intronic
1117155454 14:52935565-52935587 ACCAGGAATAGGGTCCTCACTGG + Intronic
1118319679 14:64745844-64745866 ACCAGGTCGGTGGTTCTCACTGG + Exonic
1121604793 14:95232707-95232729 TCCAAGACTCTGGTACTCACTGG - Intronic
1122577672 14:102752207-102752229 CCCAGGATTCAGGCTCTCGCAGG - Intergenic
1129182335 15:73885207-73885229 TCCAGGCTTCTGGGTCTCAGAGG + Intronic
1133260191 16:4544232-4544254 ACTACATTTCTGGTTCTCACTGG - Intergenic
1134907805 16:17996120-17996142 AACAGGATTCTGGATCTGAGAGG + Intergenic
1135720050 16:24808747-24808769 ACAAAGATTCTGGCTCCCACTGG + Intronic
1137349210 16:47696564-47696586 AATAGGATTCTGGGTCTCATAGG - Intronic
1137349218 16:47696608-47696630 AATAGGGTTCTGGGTCTCACAGG - Intronic
1138699572 16:58848131-58848153 CCTAGGATTCTGGTTCTTCCAGG + Intergenic
1139795386 16:69479029-69479051 ACCAGGATATTGGTTGTCTCTGG - Intergenic
1139796214 16:69485034-69485056 ACCACGAATCAGCTTCTCACAGG - Intergenic
1143041751 17:4043307-4043329 ACCAGGATGCTGATCCTCAGGGG + Intronic
1143742227 17:8963197-8963219 ACAGGCATTCTGGTTCTCAGAGG + Intronic
1143922306 17:10340148-10340170 ACCAGGAGTCTTGGTCTCATTGG + Exonic
1144205845 17:12979062-12979084 ACCTGGATTCTGATGCCCACAGG - Intronic
1144713009 17:17414754-17414776 GCCTGGGTTCTGGTTCACACTGG - Intergenic
1149574413 17:57701479-57701501 ACCAGGAAGCGGGTGCTCACCGG + Intergenic
1150923069 17:69504057-69504079 ACCTGGATTCTGATTCTGACTGG + Intronic
1152538790 17:80964554-80964576 ACCTGGATGCTGGTGCTCAGTGG - Exonic
1153752267 18:8244965-8244987 ACCAGGATTCTGGTCAGCATGGG + Intronic
1156129751 18:33957025-33957047 AACGAGATGCTGGTTCTCACTGG + Intronic
1156519052 18:37706105-37706127 TCTAGGGTTCTGGCTCTCACTGG + Intergenic
1158592801 18:58791700-58791722 AACAGAATTTTGTTTCTCACAGG - Intergenic
1158702726 18:59763353-59763375 ACATGGATTCTGGTTGTCTCTGG - Intergenic
1160852749 19:1201143-1201165 AACAGGTTTCTAGTTCTCTCGGG + Intronic
1162580723 19:11528764-11528786 GCCAGGATTCTGGGTCTCTTGGG + Intronic
1164930074 19:32168600-32168622 ACCAGTATCCTTGTTCTCCCAGG + Intergenic
1164940604 19:32250262-32250284 TCCAGGAGGCTGGGTCTCACTGG + Intergenic
1165686109 19:37821445-37821467 AACAGGATCCAGTTTCTCACAGG + Intergenic
1166181614 19:41112985-41113007 ACCAGGATTGCTGTTCTCAGAGG - Intergenic
1167704163 19:51068641-51068663 ACCAAGAGTCTGCTTCTCACTGG - Intergenic
925387603 2:3473024-3473046 AGCAGGATTCTTGCTCACACTGG + Intronic
926421241 2:12701821-12701843 ACCAGAGATCTGGTTCTCATTGG + Intergenic
926971826 2:18474384-18474406 ACCAGGTCTCTGGATCTCACTGG - Intergenic
928541164 2:32284789-32284811 ACCTGGATTCTGTTTGTCTCAGG - Intronic
929256701 2:39818877-39818899 ATCAGGAAGCAGGTTCTCACTGG - Intergenic
931904694 2:66829841-66829863 AGCAGGACTCAGGTCCTCACCGG - Intergenic
937813292 2:126222393-126222415 ACCAGGCAGCTGTTTCTCACTGG + Intergenic
937992606 2:127672905-127672927 GCCTGGATCCTGGTTCTCTCGGG - Intronic
937999277 2:127719634-127719656 AGCAGGACCCTGGTTCTCCCGGG + Exonic
939577399 2:143912773-143912795 AGCAGGATTCTGTTCCTCATAGG + Intergenic
941517055 2:166493093-166493115 CCCAGGATTCTGTTTATTACAGG + Intronic
945102674 2:206275613-206275635 AACAAGATACTGGTTCTCAAGGG + Intronic
946080952 2:217117855-217117877 ACCAGGAGTGTGGTGTTCACTGG + Intergenic
947545429 2:231007156-231007178 ACCAGGATTCCAGGTCACACGGG + Intronic
1173045155 20:39502729-39502751 ACCAGGATCCTGGTTCAGCCAGG + Intergenic
1173542761 20:43866969-43866991 AGCAGGATCCTGGGTCACACAGG - Intergenic
1173956420 20:47036438-47036460 CCCAGGGTTCTGGTGCACACGGG + Intronic
1174774469 20:53331445-53331467 ATCAGGATTTTGGTTCCCCCTGG - Intronic
1174801865 20:53570846-53570868 ACCAGGCTCCTGCCTCTCACAGG + Intronic
1176515637 21:7781445-7781467 ACCAGGAAGCAGGTCCTCACCGG - Intergenic
1178649665 21:34411457-34411479 ACCAGGAAGCAGGTCCTCACCGG - Intergenic
1178782420 21:35616693-35616715 ATCAGAATTCAGGCTCTCACGGG - Intronic
1180150117 21:45943068-45943090 ACCTGGATCCTGGTGTTCACGGG + Intergenic
1181657460 22:24315343-24315365 ATGAGGATACTAGTTCTCACAGG - Intronic
1182279049 22:29207639-29207661 ACCAGGTATCTGGTGGTCACTGG + Intronic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
1185308892 22:50141698-50141720 CCCAGGGCTCTGGGTCTCACGGG - Intronic
951116326 3:18867134-18867156 ACCAGGAATCAGGCTCTCACAGG - Intergenic
951693295 3:25419396-25419418 AGCAGGATTCTGGCTCACACTGG + Intronic
951806373 3:26648608-26648630 GGCAGGATTCTGGTTCTCTAGGG - Intronic
954839883 3:53501281-53501303 ACTAGGTTTCTGCTTCTTACAGG - Intronic
956023864 3:64961393-64961415 AGAAGGATTCTGATTTTCACTGG - Intergenic
958037649 3:88189325-88189347 CCAAGGATTCGGGGTCTCACGGG + Intergenic
962369661 3:134810885-134810907 AGCAGGGTACTGGTTCTCAGGGG + Intronic
963323568 3:143836141-143836163 ATCAGGGTTCTGGTGCCCACGGG - Intronic
964851343 3:161099545-161099567 ACAAGGATTCTAGTTCTGGCAGG + Intronic
965669444 3:171131393-171131415 ACTAGGGTACTGGTTTTCACAGG + Intronic
966554208 3:181240914-181240936 ACCCTGAGTCTGTTTCTCACTGG - Intergenic
966716935 3:183022044-183022066 ACCAGGATTCCAGTTGTCAGGGG + Intronic
967448806 3:189598674-189598696 CCCAGCCCTCTGGTTCTCACTGG - Intergenic
967940248 3:194760608-194760630 TCCAAAATTCTGATTCTCACTGG + Intergenic
970110835 4:12636232-12636254 TCCAGGATCCTGGGTCTCAAAGG + Intergenic
970137077 4:12936765-12936787 TCTATGATTCTGGCTCTCACCGG + Intergenic
970586352 4:17518007-17518029 ACCAGGAGTCTGTTTCTCCTGGG + Intronic
971041893 4:22762958-22762980 CCCAGGCTTCCGATTCTCACCGG - Intergenic
976315064 4:83651389-83651411 ACCAGGAAACTGGTCCTCTCTGG - Intergenic
976565854 4:86550204-86550226 CCGAGGAATCTGGATCTCACAGG + Intronic
977345066 4:95807336-95807358 AGCAGGATGCTGGTTCCAACTGG - Intergenic
978446736 4:108787474-108787496 ACCTGGATCCTGCCTCTCACGGG - Intergenic
979032582 4:115668917-115668939 ACAAAGATTCAGGTTTTCACAGG + Intergenic
983859981 4:172693728-172693750 ACCAGGATTCAGTTTTTCAGTGG - Intronic
984342187 4:178471372-178471394 ACCAGCAACATGGTTCTCACCGG + Intergenic
985901792 5:2801909-2801931 GGCAGCATTCTGGTTTTCACTGG + Intergenic
986004513 5:3656928-3656950 CCCAGGATGCTGGGTCTCCCCGG - Intergenic
986976939 5:13405688-13405710 ACCAGGCCTCAGGTCCTCACTGG + Intergenic
987218267 5:15762144-15762166 AGCAGGATTCAGTTTTTCACAGG + Intronic
988941732 5:36153844-36153866 TCCAGGGTTCTGGTTCACTCTGG - Intronic
991327007 5:65445244-65445266 AACAGGATTATGGTTATCTCAGG - Intronic
992369700 5:76130287-76130309 AACAGGAGTATGGTTCTCACAGG - Intronic
993466255 5:88250464-88250486 GTCAGGATTCTGGTTCTGAGAGG - Intronic
997672488 5:135686959-135686981 ATCAGGATTCTGCTTCTCTGTGG - Intergenic
1000409764 5:160925930-160925952 ACCAGGCATCTGCTTTTCACAGG - Intergenic
1001380202 5:171301130-171301152 AGCAGGAGTCAGTTTCTCACTGG + Intergenic
1001761284 5:174210258-174210280 GCCAGGACTCTGGGTTTCACAGG + Intronic
1002163797 5:177332516-177332538 CCCAGGAGTCTGGTTTTAACTGG - Intronic
1005727795 6:28666470-28666492 ACCAGGATTGAGGTCCTTACCGG + Intergenic
1007492284 6:42232785-42232807 ACCAGGCTTCTGCTTCCCAGAGG + Exonic
1007730135 6:43940629-43940651 ACCACGATTCAGGGTCTTACGGG + Intergenic
1007763396 6:44147355-44147377 ACCAGGCATCTGGGTCCCACAGG + Exonic
1007992461 6:46270853-46270875 AGCAGGATTCAGCTCCTCACAGG - Intronic
1009601035 6:65799700-65799722 ACCAGTATTTTGTTTCTAACAGG + Intergenic
1011893643 6:92197406-92197428 ATCAGGAGGCAGGTTCTCACTGG + Intergenic
1012726404 6:102816544-102816566 AATAGGAAGCTGGTTCTCACCGG - Intergenic
1012868175 6:104642750-104642772 ACCTGGATCCTCCTTCTCACAGG + Intergenic
1014684323 6:124477466-124477488 AAAAGGTTTTTGGTTCTCACAGG - Intronic
1018435135 6:163752451-163752473 ACCAGGATGCTGGTTCTGTGGGG + Intergenic
1019637907 7:2086188-2086210 ACCAGGCATCTTGTCCTCACTGG - Intronic
1019845420 7:3494992-3495014 ACCAGGTTTATGGTTCTGACAGG - Intronic
1020812466 7:12864111-12864133 CCCAGGCTTCAGGTTCTCCCTGG + Intergenic
1021431333 7:20561676-20561698 ACCAGGACTATTGTTCTCAAAGG + Intergenic
1022231635 7:28419633-28419655 ACTAACATTCTGGTCCTCACTGG - Intronic
1022605282 7:31807315-31807337 AGCAGGATTCTGGATCTCATGGG - Intronic
1023679932 7:42675095-42675117 ACCAGGAAGCGGGTCCTCACTGG - Intergenic
1024425983 7:49227003-49227025 ACCAGGAAGCAGGCTCTCACTGG + Intergenic
1024522010 7:50313926-50313948 AAAAGGATACTGGTACTCACTGG - Intronic
1024565025 7:50673693-50673715 ACCAGCATTCTGGTTGCCAGGGG - Intronic
1025263991 7:57440649-57440671 GGCAGGATTCTGGTGATCACTGG + Intergenic
1033155181 7:138950771-138950793 TCCAGGACTCTGGATCTCCCCGG + Intronic
1034654394 7:152717784-152717806 GCAAGGATTTTGGTTCTCAAGGG + Intergenic
1034682217 7:152937510-152937532 ACCAGGAACCAGGTTCCCACCGG - Intergenic
1035037807 7:155906797-155906819 CCCTGGACTCTGGTTCTCCCTGG + Intergenic
1041399575 8:57427971-57427993 GCAAGGATTCTGTTTCTCTCTGG - Intergenic
1043684427 8:83068623-83068645 ACCTGGATTCATGTTGTCACAGG - Intergenic
1046616638 8:116484843-116484865 CCCAGGAGCCTGGTTCTCCCAGG + Intergenic
1047028609 8:120851638-120851660 ACCAGGTTTCTGCTCCCCACTGG + Intergenic
1047652536 8:126938639-126938661 GGCAGGATTCAGCTTCTCACAGG - Intergenic
1047907840 8:129492005-129492027 AGCAGGCTTCAGGTCCTCACTGG + Intergenic
1048117218 8:131537831-131537853 TCCAGGCTTCTGGTTTTTACAGG + Intergenic
1051926634 9:22335474-22335496 TCCAGGTCTCTGTTTCTCACTGG - Intergenic
1052881589 9:33603997-33604019 AACAGGATTCTGCTGCTCATTGG - Intergenic
1053494729 9:38541840-38541862 AACAGGATTCTGCTGCTCGCTGG + Intronic
1054840687 9:69735770-69735792 AGCTGGATTCTGGTTTTCTCTGG - Intronic
1055788788 9:79899324-79899346 ACCAAGATTCTGTTTCTCTGGGG - Intergenic
1056893381 9:90517171-90517193 AGCAGGATTCTTGTTAACACTGG - Intergenic
1057259176 9:93574981-93575003 ACCTGAATTCCGGTTGTCACTGG - Intergenic
1058671082 9:107360874-107360896 GCCATGATTCTGCCTCTCACAGG + Intergenic
1058824152 9:108759746-108759768 ACCAGGAATCTGGAGTTCACTGG - Intergenic
1061560042 9:131396021-131396043 AGCTGGATTCTGGTCCTCATCGG + Intronic
1186754595 X:12657305-12657327 TGCAGGATTCAGTTTCTCACAGG + Intronic
1190002883 X:46706671-46706693 CCCAGGTATCTGGTTCTCACAGG - Intronic
1193078874 X:77384190-77384212 TCCAGGACTCTGTTTCTCCCTGG - Intergenic
1195635912 X:107115922-107115944 ACCAGGAAACTGCTTCTCTCAGG - Exonic
1199880182 X:151968160-151968182 GGCAGGATTCTGGTCCTCTCTGG - Intronic