ID: 1184191632

View in Genome Browser
Species Human (GRCh38)
Location 22:42898851-42898873
Sequence CGGATGTTTCTGCACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191632_1184191638 0 Left 1184191632 22:42898851-42898873 CCATCCCTGTGCAGAAACATCCG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data
1184191632_1184191637 -1 Left 1184191632 22:42898851-42898873 CCATCCCTGTGCAGAAACATCCG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310
1184191632_1184191639 1 Left 1184191632 22:42898851-42898873 CCATCCCTGTGCAGAAACATCCG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1184191639 22:42898875-42898897 GCAATCAGGAGCAGAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191632 Original CRISPR CGGATGTTTCTGCACAGGGA TGG (reversed) Intronic
900266097 1:1757963-1757985 CCGGTGTTTCTCCACAGGCAGGG + Intronic
901078516 1:6570464-6570486 CTGAAGTTTCTGCACAAGGAGGG + Intronic
903820065 1:26095087-26095109 CATCTGTTTCTGCCCAGGGAAGG + Intergenic
906281443 1:44556896-44556918 CAGATGTTGCTAGACAGGGAGGG + Intronic
906941557 1:50260119-50260141 AGGATATTACTGCACAGGGTGGG - Intergenic
911865701 1:103018993-103019015 CAAATGTTTTTGCACAGGGAAGG + Intronic
914973488 1:152333847-152333869 TGGATGTTAGTGGACAGGGATGG + Intergenic
915934372 1:160082140-160082162 CAGATCTCTCTGCCCAGGGATGG - Intronic
917588662 1:176454633-176454655 CACATGTTTCAGGACAGGGAGGG + Intergenic
919990739 1:202707572-202707594 AGGATGCTTCTGTCCAGGGAAGG + Intronic
920094800 1:203479321-203479343 GGAATGTTTCTGCTCAGGGCAGG - Intronic
920534595 1:206729382-206729404 CGGATGCTTCTGTAGAGGGGAGG - Exonic
924199322 1:241642448-241642470 CGCATGTCTCTGGTCAGGGAGGG + Intronic
1063047172 10:2404096-2404118 CGGATGTCTCTGCACCTGCAGGG - Intergenic
1064913933 10:20435299-20435321 CAGATTTTTCTGCCAAGGGAAGG + Intergenic
1066616323 10:37298692-37298714 TGGATTTTTCTGCTCTGGGAAGG + Intronic
1066978957 10:42393366-42393388 GGAATGTTTCTGGTCAGGGATGG + Intergenic
1068388114 10:56358903-56358925 CGGAGGTTTCTGCAGAGGTGAGG - Exonic
1070696944 10:78570697-78570719 AGGATGGGTCTACACAGGGAGGG - Intergenic
1073486769 10:103824150-103824172 TGGAGGTTTCTGCAGAAGGAGGG - Intronic
1074075141 10:110116287-110116309 AGGATGTATCTGCACCAGGAAGG - Exonic
1074945474 10:118276900-118276922 AGGATGTTACTGCACATTGATGG + Intergenic
1075216070 10:120536717-120536739 CTGATGTTTTTGCACAGTAAAGG + Intronic
1081597613 11:44469912-44469934 TTGATGTTTCTGTGCAGGGAAGG - Intergenic
1086015913 11:82167322-82167344 GGCTTGTTTCAGCACAGGGAGGG + Intergenic
1086942978 11:92817105-92817127 CGGATGTCTCTATACAGGAAGGG + Intronic
1092043041 12:5402515-5402537 TGCATGTATGTGCACAGGGAAGG + Intergenic
1093489158 12:19684926-19684948 CGGGGATTTCTGCACAGGGAAGG + Intronic
1096516084 12:52156192-52156214 TGGATGTCTCCGCCCAGGGATGG + Intergenic
1098786896 12:74770705-74770727 CAGATGGCTCTGCACAGAGATGG - Intergenic
1099529594 12:83761619-83761641 CTGATTTTTTTCCACAGGGATGG - Intergenic
1101546179 12:105715231-105715253 TGGATGTGTTTGCAGAGGGAAGG - Intergenic
1102303026 12:111784552-111784574 CTGATGTTTCTAGACAGGGCTGG + Intronic
1102308400 12:111824489-111824511 CAGATGTTTCTGCAACTGGAGGG + Intergenic
1104365833 12:128175855-128175877 CGGATTTTTCTGCAGGGGCAGGG + Intergenic
1106024683 13:25945744-25945766 CGGATTTTTCTGCTCCGGGAAGG + Intronic
1108088682 13:46822823-46822845 GGGATTATTCTGCCCAGGGATGG + Intergenic
1108245167 13:48506506-48506528 TGGATGTTAATGCAGAGGGAGGG + Intronic
1109169511 13:59077943-59077965 TTTATGTTTCTGCACAGGCAGGG - Intergenic
1113668654 13:112159949-112159971 TAGATGTTTCTGAACAGGGCTGG + Intergenic
1113763786 13:112868247-112868269 CAGAGGGATCTGCACAGGGAGGG + Intronic
1116222839 14:42111167-42111189 TGCAAGTTTCTGCACAGGAATGG + Intergenic
1117265217 14:54079486-54079508 GGGATGATGCTGTACAGGGATGG - Intergenic
1117486437 14:56202592-56202614 TGGATGTCTGTTCACAGGGAGGG + Intronic
1119439311 14:74617486-74617508 TGGATGTTCCTGCAAAGGTAAGG + Intergenic
1129009103 15:72398657-72398679 TGGATGTTTCTTGGCAGGGACGG - Exonic
1132692496 16:1187868-1187890 CAGATGTTTCTACAGAGGGACGG - Intronic
1133381453 16:5334240-5334262 GGTATGTCTCTGCTCAGGGAGGG + Intergenic
1133853397 16:9526840-9526862 CTGATGTTGCTGCATCGGGAGGG + Intergenic
1135623645 16:23976860-23976882 GGGTTGTTACTGCAGAGGGAAGG + Intronic
1135787888 16:25366789-25366811 CTGAATTTTCTGCACACGGATGG + Intergenic
1138985928 16:62328532-62328554 CGGATGTATATGCACATGCATGG - Intergenic
1139466661 16:67157702-67157724 TGGCTTTTTCTGGACAGGGAAGG - Intronic
1139783815 16:69374032-69374054 CAGTTCTTGCTGCACAGGGAAGG + Intronic
1142314649 16:89335915-89335937 CGGATGCCTCAGCACAGGCAGGG - Intronic
1142348252 16:89568018-89568040 CGGCAGCTTCTGCAGAGGGAGGG - Intergenic
1143972522 17:10805804-10805826 CTGCTGTGTCTGCACAGGGCTGG + Intergenic
1144727834 17:17510833-17510855 CGGGTGGATCTGGACAGGGAGGG - Intronic
1145734279 17:27215750-27215772 CGGGTGTATCTGCACAGGATGGG + Intergenic
1148615660 17:48998094-48998116 CGAATGTTTCTGCGCGGGGGTGG - Intronic
1151379727 17:73717435-73717457 TGGAGGTGTCTGCTCAGGGAAGG + Intergenic
1151875848 17:76868040-76868062 CGGGAGTTTCTGACCAGGGAGGG + Intergenic
1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG + Exonic
1156352210 18:36311197-36311219 AGGATGTGTCTGGGCAGGGAGGG + Intronic
1157479226 18:48042513-48042535 TGGATGTTTCTGTCCTGGGAAGG + Intronic
1161630644 19:5353520-5353542 GGGATGTTTCTGAGCTGGGAAGG + Intergenic
1163124832 19:15239211-15239233 CGGATGCTTCTGCACTAGGCTGG + Exonic
1163242319 19:16071823-16071845 AGGATGTTGCTGCCCTGGGAGGG - Intronic
1164468461 19:28508130-28508152 CGGATATATCTGCTGAGGGAAGG - Intergenic
1166487255 19:43223988-43224010 CCTATGTTTCTGCTCAGGTACGG + Intronic
1167883088 19:52478463-52478485 CAGATGTTTCTGCAATTGGAGGG + Intronic
1168053772 19:53849378-53849400 TGGATGTTACAACACAGGGAAGG - Intergenic
1168310026 19:55455547-55455569 TGGAGGTTTCTGGTCAGGGAAGG + Intronic
1168490527 19:56805040-56805062 AGGATGGTTCTGCAAAGGAAGGG - Intronic
925650795 2:6087111-6087133 GGCATGTTTCTGGTCAGGGAGGG - Intergenic
927503111 2:23595496-23595518 CAGATGTCTCTGCACAGGCCTGG + Intronic
928419748 2:31128996-31129018 CTGGTGTTTCAGCAGAGGGAGGG + Intronic
932805329 2:74778215-74778237 AGGAGGGTTCTGCAGAGGGAGGG + Intergenic
933565326 2:83943421-83943443 TGGATGTACCTGCACAGGCAAGG + Intergenic
936341067 2:111633202-111633224 CAAATGGTTCTGAACAGGGAGGG - Intergenic
937103098 2:119286642-119286664 CCGATGGTTCTGAACAGGGAGGG + Intergenic
943241745 2:185393341-185393363 GGGATGTCTCTGGTCAGGGAGGG + Intergenic
947916392 2:233834623-233834645 GAAATGTTTCTGCACAGGCATGG - Intronic
948094076 2:235319844-235319866 CAGTTGTTTCTGCACAGTGAGGG + Intergenic
1168905216 20:1397892-1397914 CAGATGTTTCTGCAACTGGAGGG - Intergenic
1168961974 20:1876219-1876241 GGGCTGTTTCTTCCCAGGGAAGG + Intergenic
1169016567 20:2297515-2297537 CGGGAGGTCCTGCACAGGGATGG - Intronic
1169826300 20:9772422-9772444 GGGATATTCCTTCACAGGGATGG - Intronic
1171409021 20:24933753-24933775 CTGTTGTTTCTGCAGAGGCAAGG - Intergenic
1172181960 20:33009069-33009091 TGGATGTGTGTGCACAGGTACGG + Intronic
1173885599 20:46455949-46455971 TGCAGGTTTCTGCACATGGAGGG + Intergenic
1175696475 20:61106500-61106522 CAGATGGCTCTGCTCAGGGAAGG - Intergenic
1175839802 20:62019738-62019760 CTGGTGTTTCTCCTCAGGGAGGG - Intronic
1179143038 21:38744085-38744107 CGGATCTTTTTGCAGTGGGAGGG - Intergenic
1180171764 21:46062975-46062997 CGGCTTATTCTGCACAGGGCAGG + Intergenic
1181002117 22:19992737-19992759 TCCATGTCTCTGCACAGGGAGGG - Intronic
1182130682 22:27848258-27848280 TGGATGTTTCTGCATTGTGAGGG + Intergenic
1184108316 22:42381414-42381436 GAGATGTTTCTGCAGAGGGGAGG + Exonic
1184191632 22:42898851-42898873 CGGATGTTTCTGCACAGGGATGG - Intronic
1185214722 22:49591954-49591976 GGGATCTTTCTGGAAAGGGAAGG - Intronic
953479911 3:43242658-43242680 CTGATGTGGCTGCACATGGAGGG - Intergenic
953804138 3:46053421-46053443 CAGATGTTTCTGCAACTGGAGGG + Intergenic
953846088 3:46427607-46427629 CAGATGTTTCTGCAACTGGAGGG - Intergenic
954843478 3:53533725-53533747 CTGATGCTCCTGGACAGGGAAGG + Intronic
955783492 3:62511061-62511083 AGGCTGTTTATGCAAAGGGATGG - Intronic
956862635 3:73339619-73339641 AGGAAGTGTCTGAACAGGGAGGG - Intergenic
957354427 3:79063026-79063048 TAGATGTTTCTGTACAGGGCAGG + Intronic
959946741 3:112133257-112133279 AGGGTGTCTCTGCAGAGGGAAGG + Intronic
959948096 3:112148919-112148941 CTGAGTTCTCTGCACAGGGATGG + Intronic
960875394 3:122290236-122290258 CTGAAGTTTCAGCACATGGATGG + Intergenic
962173214 3:133124849-133124871 CGGTTCTTTCTGCTCAGGAATGG + Intronic
967867574 3:194203225-194203247 CATATGTTTCTGCACAGAAATGG - Intergenic
968754174 4:2406492-2406514 AGCATGTTTCCCCACAGGGAGGG - Intronic
969599895 4:8170126-8170148 GCGATGTTTCTGCCAAGGGAAGG + Intergenic
979071011 4:116206352-116206374 CAGATGTTTTTGCAGAGGCAAGG + Intergenic
979314140 4:119240209-119240231 TGGATGTTTTTTCAAAGGGAGGG - Intronic
982845368 4:160246195-160246217 CCTATGTTTGTGCACAGGGATGG + Intergenic
984423467 4:179553985-179554007 CACATGTTTCTGCACAGGGTTGG + Intergenic
985057768 4:186050186-186050208 CACATGTTTCTGCACAGGGTTGG - Intergenic
988526668 5:31993127-31993149 AGGATGTTTCTGAATGGGGAAGG + Intronic
988963307 5:36390937-36390959 AGGCTGGCTCTGCACAGGGATGG + Intergenic
989609477 5:43277484-43277506 TGGATGTTGCTTCACAGGCAAGG - Intronic
990957019 5:61351978-61352000 CTGAAGGTTCTGCACAGGGTAGG - Intronic
995145476 5:108783847-108783869 CTGATGTCTCTGGACAGGGGAGG + Intronic
995546436 5:113236796-113236818 CGGATGTTTGTTCAGGGGGACGG + Intronic
996738636 5:126778614-126778636 CGGGTGGTTCTGCGCAGGGAAGG + Intronic
996798306 5:127375082-127375104 GGGTTGCTGCTGCACAGGGAGGG - Intronic
998103786 5:139455607-139455629 GGAATGTTTCTGCTCAGGCAAGG + Intronic
999197191 5:149790418-149790440 CAGACCTGTCTGCACAGGGAGGG - Intronic
999200383 5:149812115-149812137 CGGATGCTTCCGCACAGAAAGGG + Intronic
1002076588 5:176712135-176712157 TGGATCTGTCTACACAGGGAGGG + Intergenic
1004599394 6:17133016-17133038 CCAAGTTTTCTGCACAGGGATGG - Intergenic
1005996871 6:30936867-30936889 GTGATGCTTCTGCACTGGGAGGG - Intergenic
1006212153 6:32405127-32405149 CCTGTGTTTGTGCACAGGGATGG - Exonic
1008295631 6:49772473-49772495 AGGATGTCTCTGGTCAGGGAGGG + Intergenic
1012064250 6:94529378-94529400 AGTATGTTTCTGGACAGGGGAGG - Intergenic
1013110526 6:107061356-107061378 AGAACGTTTCTTCACAGGGAAGG - Intergenic
1013463313 6:110396255-110396277 CAGAGGTCTCTGCAGAGGGAGGG - Intronic
1014726660 6:124979309-124979331 TGGTTGTTGCTGCACAGGGAGGG + Intronic
1014878480 6:126691423-126691445 AGTATGTTTCTGCACAGAGGAGG + Intergenic
1016500716 6:144718009-144718031 CAGATGTTCCTGCAAACGGAGGG + Intronic
1018715981 6:166533016-166533038 TGGAAGTTACTGCACATGGAAGG + Intronic
1023601875 7:41888488-41888510 CGGATGTTGTGGCACAGGGAAGG - Intergenic
1023823761 7:43995073-43995095 TGCATGTTTCTGCACCTGGAGGG + Intergenic
1026593606 7:71716119-71716141 CCCATGTCTCTGCACAAGGATGG + Intergenic
1029752028 7:102548486-102548508 TGCATGTTTCTGCACCTGGAGGG + Intronic
1029769980 7:102647580-102647602 TGCATGTTTCTGCACCTGGAGGG + Intronic
1031443220 7:121819346-121819368 CGAAAGTTTCTGCACAATGAAGG + Intergenic
1033550347 7:142441346-142441368 CCAGAGTTTCTGCACAGGGAGGG - Intergenic
1038423087 8:27446073-27446095 CTGATGTGTTTGCAAAGGGAAGG - Intronic
1039792688 8:40888183-40888205 CTGATGTTTCTGGAGAAGGAGGG - Intronic
1047610209 8:126513340-126513362 GGGATGATTCTGCACAGGTAGGG - Intergenic
1048623780 8:136162693-136162715 CCCATGTTTCTGCAATGGGATGG - Intergenic
1049632532 8:143666389-143666411 GGGATGTGTGTGCACACGGAGGG - Intergenic
1049632605 8:143666731-143666753 GGGATGTGTGTGCACACGGAGGG - Intergenic
1049632626 8:143666829-143666851 GGGATGTGTGTGCACACGGAGGG - Intergenic
1049632673 8:143667031-143667053 GGGATGTGTGTGCACATGGAGGG - Intergenic
1057549525 9:96041700-96041722 AGTGTGTTTCTGCCCAGGGATGG - Intergenic
1057980621 9:99658669-99658691 CTGATGTGTCTGGACAGGAAAGG - Intergenic
1059434136 9:114266303-114266325 AGGAGGTTTCTGATCAGGGAGGG + Intronic
1062556946 9:137117360-137117382 CGGGGGTGTCTGCACAGGCATGG - Intergenic
1186444573 X:9615808-9615830 GGGAGCTTTTTGCACAGGGAAGG + Intronic
1188683486 X:33040993-33041015 GGGATGTTTCAGCACAGTGATGG + Intronic
1190497596 X:51041513-51041535 CACATGTTTCTGGGCAGGGAGGG + Intergenic
1191025640 X:55909948-55909970 CTTATGTTTCTGCACAGGGAGGG + Intergenic
1191192137 X:57678808-57678830 AGGATGTCTCTGTCCAGGGACGG + Intergenic
1193305389 X:79944609-79944631 GGGATGTGTCTGCACTGGCAGGG + Intergenic
1200393383 X:155967258-155967280 CAGAGGATTCTGCACAGGAAGGG + Intergenic