ID: 1184191633

View in Genome Browser
Species Human (GRCh38)
Location 22:42898855-42898877
Sequence TGCACGGATGTTTCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191633_1184191639 -3 Left 1184191633 22:42898855-42898877 CCCTGTGCAGAAACATCCGTGCA No data
Right 1184191639 22:42898875-42898897 GCAATCAGGAGCAGAGAAAGGGG No data
1184191633_1184191638 -4 Left 1184191633 22:42898855-42898877 CCCTGTGCAGAAACATCCGTGCA No data
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data
1184191633_1184191637 -5 Left 1184191633 22:42898855-42898877 CCCTGTGCAGAAACATCCGTGCA No data
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191633 Original CRISPR TGCACGGATGTTTCTGCACA GGG (reversed) Intronic
No off target data available for this crispr