ID: 1184191634

View in Genome Browser
Species Human (GRCh38)
Location 22:42898856-42898878
Sequence TTGCACGGATGTTTCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191634_1184191639 -4 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191639 22:42898875-42898897 GCAATCAGGAGCAGAGAAAGGGG No data
1184191634_1184191638 -5 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data
1184191634_1184191641 30 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191641 22:42898909-42898931 ACCCAGCAGCTTATTGTCACAGG 0: 1
1: 0
2: 0
3: 7
4: 149
1184191634_1184191637 -6 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191634 Original CRISPR TTGCACGGATGTTTCTGCAC AGG (reversed) Intronic
900593558 1:3470306-3470328 CTGCACGGGTGTGTCTGCACGGG + Intronic
903638987 1:24844619-24844641 TTTCACTGATGTTACTGCATTGG - Intergenic
909898528 1:81104698-81104720 TTGCATCCATGTTGCTGCACAGG + Intergenic
915646587 1:157277084-157277106 TTGAAAGGATGTTTCTGCCTAGG + Intergenic
917004744 1:170401656-170401678 TTGCATCCATGTTTCTGCAAAGG - Intergenic
1067043748 10:42972544-42972566 TTGCACAGATGTTTTGGCCCAGG - Intergenic
1070893706 10:79963815-79963837 TTGCACCCATGTTGCTGCAAAGG + Intronic
1071881643 10:89905199-89905221 TTGCAGTGATGTTGCTGCAAAGG + Intergenic
1073065838 10:100758820-100758842 TTGCGTGGATGTTACTGCCCTGG - Intronic
1079969100 11:27014736-27014758 TTCCAGTGATGTTTCTTCACAGG - Intergenic
1084471931 11:69367403-69367425 TTTCACAGATGATTCTGCAGGGG - Intronic
1084762779 11:71284471-71284493 TTGCGAGGATGTTTCTGGATGGG + Intergenic
1086816053 11:91372333-91372355 TTGCAGGGTTCTTCCTGCACAGG + Intergenic
1090106811 11:123862210-123862232 TTGCAATGATGGTGCTGCACAGG + Intergenic
1091287740 11:134417471-134417493 TACCACGGATTTTTCTGCAGGGG + Intergenic
1091912605 12:4244114-4244136 GTGCAAAGATGTTTCTGCAGTGG - Intergenic
1095279839 12:40337187-40337209 TTCCAAGTATGTTTCAGCACAGG + Intronic
1098800921 12:74956730-74956752 TTGCATGGACATTTTTGCACTGG + Intergenic
1099344092 12:81476408-81476430 TTTCAGGGATGATTCTGCAATGG - Intronic
1105237721 13:18574153-18574175 TTGCATGCAGGTTTCTCCACTGG - Intergenic
1108867828 13:54942601-54942623 TTGAAAGGATGTCTCTGCCCAGG + Intergenic
1116195803 14:41723456-41723478 TTGCACCAAGATTTCTGCACAGG + Intronic
1127290733 15:57568532-57568554 TTGCAAGGATATATTTGCACTGG - Intergenic
1138260020 16:55611558-55611580 TTGCATGGAGGGTTCTGCAGAGG + Intergenic
1138268830 16:55680171-55680193 TTGGATGGATGGTTCTGCAGTGG + Intronic
1139890907 16:70252810-70252832 TGGCAAGGATGTGTCTGCACAGG - Exonic
1140125953 16:72119289-72119311 TTCCACGGGTGTTTCTTCAGAGG - Exonic
1144383203 17:14723580-14723602 TTTCACCCATGTTTCTGCAAAGG - Intergenic
1145032843 17:19518314-19518336 TTGCACAGAGCTTTCTGGACTGG + Intronic
1145734277 17:27215745-27215767 CTGTACGGGTGTATCTGCACAGG + Intergenic
1146799769 17:35809379-35809401 CAGGAGGGATGTTTCTGCACTGG - Intronic
1153721062 18:7903590-7903612 ATGCACGGATATTCCTGCAATGG - Intronic
1156426598 18:37020043-37020065 TTGCACGAAGATCTCTGCACAGG + Intronic
1157271341 18:46278719-46278741 TTGGAAGGATGCCTCTGCACTGG - Intergenic
1158426507 18:57344869-57344891 TTACAAGGATGTTTGAGCACAGG - Intergenic
1158595666 18:58813814-58813836 TTACAAGGATCTTTCTGAACTGG + Intergenic
1158955586 18:62534978-62535000 TTCCAAGAATGTTTTTGCACTGG + Intronic
1160358693 18:78251225-78251247 TTGCCCAAATGTTTCTGCCCAGG - Intergenic
1160486343 18:79296623-79296645 TTGCACTACTGTTTCTGCCCTGG - Intronic
1163295918 19:16412762-16412784 TTCCACGGAGGTTTCAGCAGTGG + Intronic
1202688002 1_KI270712v1_random:65450-65472 TTGAAGAGATGTTTCTGCCCTGG - Intergenic
933659480 2:84915857-84915879 TTCCACGGAGGTTTCGGCAGTGG + Intergenic
936772522 2:115931760-115931782 TTCCACGGAGCTTTCTGTACAGG + Intergenic
939936387 2:148298475-148298497 TTGCACAAATGTTTCTTCATTGG + Intronic
943141858 2:183992971-183992993 CTGCACCAATATTTCTGCACAGG + Intergenic
948996743 2:241584461-241584483 TTGTCCAGATGTTTCTGTACTGG - Exonic
1172972098 20:38881170-38881192 TTGCATGGTGGTTTCTGCAGTGG - Intronic
1174814144 20:53672144-53672166 TTGCAAAGATGTTTCTGTAAGGG - Intergenic
1180139863 21:45886718-45886740 GAGCAGGGAGGTTTCTGCACAGG - Intronic
1181681855 22:24500880-24500902 TTTCAGGGATTTTCCTGCACAGG + Intronic
1184191634 22:42898856-42898878 TTGCACGGATGTTTCTGCACAGG - Intronic
949446754 3:4143275-4143297 TTGCACCAACTTTTCTGCACTGG - Intronic
953681362 3:45040939-45040961 TTGCATTGATGTTTCTCCCCTGG - Intergenic
957170871 3:76735278-76735300 CTGCACCCATGTTTCTGCAAAGG - Intronic
959733777 3:109633925-109633947 TTGCATCCATGTTGCTGCACAGG + Intergenic
963363440 3:144304840-144304862 CTTCAAGCATGTTTCTGCACAGG + Intergenic
963679700 3:148358816-148358838 TTGCAGGGATGTTTATGCTGGGG + Intergenic
968848780 4:3063463-3063485 GTGCAAGGAGGTCTCTGCACTGG + Intergenic
972110138 4:35547708-35547730 TTGCATCCATGTTTCTGCAAAGG - Intergenic
975661232 4:76690414-76690436 GTGCACGGGAGCTTCTGCACTGG + Intronic
977051726 4:92136600-92136622 TGGCCCCCATGTTTCTGCACGGG + Intergenic
977518855 4:98056035-98056057 TTGCTGGTATGTGTCTGCACAGG + Intronic
978212887 4:106158970-106158992 ATGCAAGGATGTTTCGCCACAGG + Intronic
981427198 4:144617271-144617293 TTGCATCCATGTTTCTGCAAAGG - Intergenic
985638072 5:1049694-1049716 TTGCAGGGTTGTAGCTGCACGGG - Intergenic
987438412 5:17926109-17926131 TTGCAAAGATGTTTCTGGACAGG - Intergenic
988200861 5:28066733-28066755 TTGCTGGCATGTGTCTGCACTGG + Intergenic
990622965 5:57579909-57579931 TTGCATGCATGTTACTGCAAAGG + Intergenic
993331791 5:86609428-86609450 TTCCACTGATGTTGCTGCAAAGG + Intergenic
996240967 5:121200934-121200956 ATGGATGGGTGTTTCTGCACTGG + Intergenic
1006914131 6:37583738-37583760 TTGCACACAAGTCTCTGCACAGG + Intergenic
1009804723 6:68588695-68588717 TTTCATTCATGTTTCTGCACAGG + Intergenic
1012354785 6:98300314-98300336 TTGCTTGGATGTTTATGCAATGG - Intergenic
1017677838 6:156832530-156832552 TTGCTCGTATATTTCTGCACAGG + Intronic
1017894715 6:158669054-158669076 TTCCACTGATGTTTCTTCCCGGG + Intronic
1018477258 6:164155876-164155898 TTCCACCCATGTTTCTGCAAAGG - Intergenic
1023877535 7:44295462-44295484 TTCCATGGAGGTTTCTGCTCTGG - Intronic
1027783651 7:82551850-82551872 CTGCACTGATGTTGCTGCAAAGG + Intergenic
1031904642 7:127447168-127447190 CTGCACCAAGGTTTCTGCACAGG - Intergenic
1039264432 8:35809086-35809108 TTGCTGGCATGTGTCTGCACTGG + Intergenic
1041191605 8:55361151-55361173 ATGCACGGCTGTACCTGCACAGG + Intronic
1042272410 8:66968317-66968339 TTGGACAGATGTTGCTTCACTGG + Intronic
1052224104 9:26063368-26063390 TTGTACTGATGTTTCTGTTCCGG - Intergenic
1057040148 9:91842077-91842099 TTGCAGGCATGGGTCTGCACAGG - Intronic
1058558131 9:106192342-106192364 ATGCATGGATGGTTCAGCACAGG - Intergenic
1059060711 9:111033002-111033024 TTGCACGTTTGTTTTAGCACTGG + Intronic
1191190794 X:57665088-57665110 TTCCATGCATGTTTCTGCAAAGG - Intergenic
1191695439 X:63985434-63985456 CTGCACGGTAGCTTCTGCACTGG + Intergenic
1193403207 X:81070348-81070370 TTGCACGCATGTCCCTGCAAAGG - Intergenic
1193699032 X:84741193-84741215 TTGAAAGGATGTTTCTGCCTAGG - Intergenic
1199569825 X:149256134-149256156 TAGCAGGGGTGTTTCTGCAAGGG + Intergenic
1201932726 Y:19370904-19370926 CTGCACTCATGTTTCTGCAAAGG + Intergenic