ID: 1184191637

View in Genome Browser
Species Human (GRCh38)
Location 22:42898873-42898895
Sequence GTGCAATCAGGAGCAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191632_1184191637 -1 Left 1184191632 22:42898851-42898873 CCATCCCTGTGCAGAAACATCCG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310
1184191633_1184191637 -5 Left 1184191633 22:42898855-42898877 CCCTGTGCAGAAACATCCGTGCA No data
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310
1184191634_1184191637 -6 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191637 Original CRISPR GTGCAATCAGGAGCAGAGAA AGG Intronic
901716073 1:11155625-11155647 GTACAATGAGGAGCACAGTATGG - Intronic
901757657 1:11451123-11451145 GAGCAATGATGAGCAGAGACTGG + Intergenic
902754185 1:18538194-18538216 GAGCTCTCTGGAGCAGAGAAGGG - Intergenic
904329088 1:29746251-29746273 GTGCTGGCAGGAGCAGAGACTGG + Intergenic
904750327 1:32737760-32737782 CTGGAGTCAGGAGCAGTGAAGGG + Intergenic
906222105 1:44088862-44088884 GTGAAATTGGGAGCAAAGAAGGG + Intergenic
906754584 1:48297967-48297989 GTGCAACCAGAATCAGAAAATGG - Exonic
909553225 1:76923302-76923324 GGACAATCAGGAACAGAGAATGG + Intronic
910447811 1:87316656-87316678 GTGAAATCAGGAACAGGGCAAGG - Intergenic
910450509 1:87338868-87338890 GTGGACTCAGGAGCAGATAGAGG + Intronic
912319596 1:108699656-108699678 GTAGAAGCAGAAGCAGAGAAAGG + Exonic
912579345 1:110706024-110706046 GTGCAAGCGGGAAGAGAGAAGGG - Intergenic
912869645 1:113292316-113292338 GGGCAATGAGGAGTAGAGAGAGG + Intergenic
912934400 1:113990345-113990367 GGTCAATGAGGAGCAGAGACAGG - Intergenic
915146913 1:153800796-153800818 CAGCAGTCAGGAGCAGAGATGGG - Intergenic
916215372 1:162389104-162389126 GTGCAAACAGTAGCAGGGAGGGG - Intergenic
920569496 1:207005858-207005880 ATGAAGTCAGGAGCAGTGAAGGG + Intergenic
920837904 1:209528807-209528829 GTGCATTTAGGAGCTGAGAAAGG + Intergenic
924174062 1:241371846-241371868 CTGTAAGCATGAGCAGAGAATGG - Intergenic
1062882934 10:993217-993239 CTGCAATGTGCAGCAGAGAAAGG - Intronic
1062884029 10:1003011-1003033 GTTCAAGAAGGAGAAGAGAAGGG - Intronic
1063136448 10:3221135-3221157 GTGCATGCAGGAAGAGAGAAAGG + Intergenic
1065458896 10:25934833-25934855 GTGGAAACAGGAGGAGGGAACGG + Intronic
1066259053 10:33711277-33711299 CTGCACACAGGAGCAGATAAGGG + Intergenic
1068194582 10:53699195-53699217 GTGCATCTAGGAGCTGAGAATGG - Intergenic
1069914889 10:71781387-71781409 GTGAAAACAGCAGAAGAGAAAGG - Intronic
1070088942 10:73265007-73265029 GTGCAAAAAGAAGCAGAGGAAGG - Intronic
1070911398 10:80121910-80121932 TTGCATTCTGGAGCAGAAAAAGG + Intergenic
1073044911 10:100631350-100631372 GAGCAAACAGGTTCAGAGAAGGG - Intergenic
1074141869 10:110680369-110680391 GTGCCATCAGGAGAAGAAAGAGG - Intronic
1079289817 11:19177874-19177896 CTGCAAGGAGGAGCAGAAAAGGG + Intergenic
1079333250 11:19550520-19550542 GTGGATTCTGGAGCAGAGATTGG + Intronic
1080820136 11:35797811-35797833 GTGAAATCTGGAGCAGGAAAGGG + Intronic
1080915907 11:36659129-36659151 ATGCAAGCAGCAGAAGAGAAAGG + Exonic
1084677018 11:70641450-70641472 GTGAGATCAACAGCAGAGAATGG + Intronic
1085537534 11:77232256-77232278 TTTCATTCAGGGGCAGAGAAAGG + Intronic
1088947417 11:114528825-114528847 GTGCCATCCTGAGAAGAGAAAGG + Intronic
1090270978 11:125385989-125386011 GTGCAGACAGGAGGAAAGAAGGG + Intronic
1090363457 11:126188557-126188579 GAGCTTTCAGGAGGAGAGAAGGG - Intergenic
1092579311 12:9821160-9821182 GAGTAATCAGGAGGAGAGAATGG - Intergenic
1092815192 12:12306454-12306476 GAGCAATCAAAAGCAGAAAATGG + Intergenic
1096099532 12:48961263-48961285 GAGCAAACAGGAGCAGAGATAGG + Intergenic
1096240432 12:49956903-49956925 CTGCTCTCAGGACCAGAGAAGGG + Exonic
1096848663 12:54421381-54421403 GTGTAAACAGGAGCAGGGAATGG - Intergenic
1097326919 12:58287785-58287807 GTGCAGTGAGAAGCAGAGAGAGG - Intergenic
1097436691 12:59558713-59558735 GAGAAATCAGAAGCAAAGAATGG + Intergenic
1097803578 12:63941200-63941222 GCGCAAACAGTAGGAGAGAAAGG - Intronic
1097804418 12:63949899-63949921 GTTCAATCAGTATCAGGGAAGGG - Intronic
1098715483 12:73824314-73824336 TTGAAAAGAGGAGCAGAGAAGGG + Intergenic
1099529064 12:83753170-83753192 TTGCTTACAGGAGCAGAGAAAGG + Intergenic
1100652803 12:96609210-96609232 TGCCATTCAGGAGCAGAGAAGGG - Intronic
1101869903 12:108557504-108557526 GTGCAATCAAAGGCAGGGAAGGG + Intronic
1102081855 12:110104617-110104639 TTTCTATCAGGAGCAGAGAGAGG + Intergenic
1105794078 13:23833639-23833661 GAACAACCAGGAGCAAAGAAAGG - Intronic
1107276395 13:38685295-38685317 GGGCATCCAGGAGCATAGAAGGG - Intergenic
1107483113 13:40801618-40801640 GATTAATCAGGAGCAGTGAAAGG + Intronic
1109262564 13:60161392-60161414 GTGCAATCAAGAGCAGTGAAAGG + Intronic
1113491172 13:110693233-110693255 GTGCAGCCACGTGCAGAGAAGGG - Intronic
1114182077 14:20375891-20375913 GAGCAATCAGGACCAAAGGAAGG + Intronic
1114390276 14:22300601-22300623 GTGAAATGAGGAGGAGATAATGG - Intergenic
1114622139 14:24102605-24102627 GTGTGATAAGGAGCAGAGAGAGG - Intronic
1117256587 14:53984516-53984538 GTGGAATGAGGTTCAGAGAAGGG - Intergenic
1119427346 14:74544290-74544312 GTGCAAGAAGCAGCAGAGAGAGG + Intronic
1119516261 14:75251044-75251066 TTGCAATGAGTAGCAGAGCAGGG + Intronic
1119963444 14:78885894-78885916 AAGCAATTAGGAGCAGAGGAAGG + Intronic
1121191903 14:92038356-92038378 GGGCAGTCAGAAGCACAGAAGGG - Intronic
1121239995 14:92422505-92422527 GGGCAAACTGGAGCACAGAAAGG - Intronic
1121908557 14:97768864-97768886 GTCCAACCAGAAGCAGGGAAAGG + Intergenic
1122706729 14:103626552-103626574 GTGAACTCAGGAACAGATAAGGG + Intronic
1123452034 15:20373580-20373602 ATGCACTCAGTAGAAGAGAATGG + Intergenic
1123452035 15:20373604-20373626 ATGCACTCAGTAGAAGAGAATGG + Intergenic
1124468746 15:29964467-29964489 GTGAAGACAGAAGCAGAGAATGG + Intronic
1124625436 15:31304927-31304949 GGGCATTCGGGAGCAGAGAAGGG + Intergenic
1124955700 15:34359041-34359063 ATTCAAACAGGAGCAGAGATGGG + Exonic
1125165155 15:36695460-36695482 ATGAAATCAGGAGCAGAACATGG - Intronic
1125251334 15:37708212-37708234 GTGAAATCCAGAGCAGAGATGGG + Intergenic
1125893964 15:43286587-43286609 GAGAAAGGAGGAGCAGAGAATGG - Intronic
1126331741 15:47539715-47539737 ATACAAACAGGAGCAAAGAAAGG + Intronic
1126472750 15:49032056-49032078 GATCCATTAGGAGCAGAGAAAGG - Intronic
1127347651 15:58116628-58116650 GTGAAATCAGTAGCAGAACAAGG + Intronic
1128535529 15:68487136-68487158 GTGTACTCCAGAGCAGAGAAGGG - Intergenic
1129458130 15:75686570-75686592 AGGCCATCAGGAGCAGAGAATGG - Intronic
1129725656 15:77900312-77900334 AGGCCATCAGGAGCAGAGAATGG + Intergenic
1130273686 15:82465502-82465524 AGGCCATTAGGAGCAGAGAATGG + Intergenic
1130466034 15:84192873-84192895 AGGCCATTAGGAGCAGAGAATGG + Intergenic
1130498229 15:84480663-84480685 AGGCCATTAGGAGCAGAGAATGG - Intergenic
1130588326 15:85197469-85197491 AGGCCATTAGGAGCAGAGAATGG + Intergenic
1130875156 15:88007370-88007392 GAACAATCAGGACCAGGGAATGG + Intronic
1130898351 15:88188198-88188220 GTTCAATCAGAAACAGAGAGTGG + Intronic
1131321599 15:91399031-91399053 GTTCCAGAAGGAGCAGAGAAAGG - Intergenic
1131459707 15:92609519-92609541 CTGCACGCAGGACCAGAGAACGG - Intergenic
1131843889 15:96468582-96468604 GTGAAACCAGGAACAGAGATGGG + Intergenic
1133320281 16:4909297-4909319 GGGCCATCAGGAGCAGCCAAGGG + Intronic
1133635467 16:7661003-7661025 GTGGGATCATGAGCACAGAAAGG + Intronic
1134371843 16:13633260-13633282 GTGGCAACAGGAGCAGAGATTGG + Intergenic
1139536442 16:67577798-67577820 GTGCAGCCAGGAGGAGAGTAAGG + Intronic
1140815934 16:78621065-78621087 GTGGCAGCAGGAGAAGAGAAAGG - Intronic
1142359883 16:89621019-89621041 GTGCCATCACGGGCAGTGAAGGG + Intronic
1143096519 17:4481211-4481233 GGGCAAGCAGGAGGAGAGAGGGG + Intronic
1143173849 17:4945425-4945447 GAGCCATCTGGACCAGAGAATGG - Intergenic
1144357290 17:14458364-14458386 GTGCAGACTGGAGCAGAGAGTGG - Intergenic
1144363945 17:14524071-14524093 GAGAAATCAGGTACAGAGAAAGG + Intergenic
1144943693 17:18959119-18959141 CTCCAATCTGGAGGAGAGAAAGG - Exonic
1146957895 17:36947561-36947583 GGGCACTCAGGAGAAGAAAACGG - Intergenic
1148540444 17:48476095-48476117 GGGCATTCAGCAGCAGACAAGGG + Intergenic
1152008129 17:77695146-77695168 GTGCCCTCAGGTGCAGAAAAGGG - Intergenic
1152181183 17:78822739-78822761 GTAGAACCAGGAGCAGAGACTGG - Intronic
1154338239 18:13482681-13482703 GTGGACTCAAGAGCAGACAATGG + Intronic
1155323295 18:24640455-24640477 GAGAAATCAGGTGGAGAGAAAGG + Intergenic
1156895435 18:42240500-42240522 ATGCAATCAGGAGCGAGGAATGG - Intergenic
1158746687 18:60207887-60207909 GTGCCACCAGAAGCAAAGAAAGG + Intergenic
1160433239 18:78826753-78826775 GTGGCATCAGGAGCAGAGCCGGG - Intergenic
1160433246 18:78826794-78826816 ATGCCATCAGGAGCAGAGCTGGG - Intergenic
1161513786 19:4685426-4685448 GTGCAAACGGGCACAGAGAAAGG + Intronic
1163312958 19:16525137-16525159 GTGCACTCAGGAGCATGGCAGGG + Intronic
1167702272 19:51056503-51056525 TGGGAATAAGGAGCAGAGAAGGG + Intronic
925155194 2:1643591-1643613 ATGAAAGCAGGATCAGAGAAGGG + Intronic
927664304 2:25019351-25019373 GTGCAATATGGACCAGGGAAAGG - Intergenic
928935068 2:36667841-36667863 GGACAATGATGAGCAGAGAATGG + Intergenic
929095002 2:38254807-38254829 GAGTGATCAGGAGTAGAGAAAGG - Intergenic
930246003 2:48983940-48983962 ATCCACTCAGGAGCAGAGCAAGG - Intronic
930696596 2:54417700-54417722 GTTCATTCAGAAGCAGGGAAGGG - Intergenic
931258438 2:60595857-60595879 CAGCACTTAGGAGCAGAGAAAGG + Intergenic
931870801 2:66457505-66457527 GAGAAATGAGGAGAAGAGAAGGG - Intronic
931883110 2:66587550-66587572 CTGCAATCTAGAGCAGAGCAAGG + Intergenic
935377514 2:102414803-102414825 GAGAAATCAGGTGGAGAGAAAGG - Intergenic
936062167 2:109302095-109302117 CTGCAATCGATAGCAGAGAATGG + Intronic
936995069 2:118404777-118404799 GTTCTCTGAGGAGCAGAGAAAGG + Intergenic
937054187 2:118917837-118917859 GTGCATTTAGGGGCAGAGAAGGG - Intergenic
937195798 2:120155593-120155615 GTTCTATAAGGAGAAGAGAAAGG - Intronic
937425450 2:121795118-121795140 GTGCACTCAGGGGCTGAGGATGG + Intergenic
937921791 2:127136520-127136542 AGGCATCCAGGAGCAGAGAAGGG + Intergenic
938175929 2:129128741-129128763 GGGCAATCAGGAACAGAGTTGGG - Intergenic
938287186 2:130128311-130128333 GTGCAATCTTGAGCAGGGCAGGG - Intronic
938428407 2:131210559-131210581 GTGCAATCTTGAGCAGGGCAGGG + Intronic
938979201 2:136509560-136509582 GTGAAATGAGGCTCAGAGAAGGG - Intergenic
939691503 2:145267513-145267535 CTGGAATAAGGAGCAGAGAGAGG - Intergenic
939716463 2:145590263-145590285 TTGCAATGAAGAGCAGAGAATGG + Intergenic
939981308 2:148784980-148785002 GTGCCATCAGCAGCATAGCAAGG + Exonic
940378914 2:152990787-152990809 GGGGAATGAGGAGCAGAGAGAGG + Intergenic
942208417 2:173646757-173646779 GTGCAATCAGCAGCACACACAGG - Intergenic
942226811 2:173823724-173823746 GTGCACTCAGGTGCTGAGGAAGG - Intergenic
942465473 2:176203316-176203338 GTGCAGTGTGGAGCACAGAAGGG - Intergenic
942865941 2:180675081-180675103 GTGGGATTAGGAGGAGAGAATGG + Intergenic
943046652 2:182868070-182868092 GTTCAATCTGGAGGAGAAAATGG + Intergenic
943958802 2:194231825-194231847 ATGCAATAAGGAGAAGAGGAGGG + Intergenic
944674807 2:202026381-202026403 GTGGCAGCAGGAGCAGAGGAAGG - Intergenic
946277603 2:218643073-218643095 GTGGCAGCAGGAGCAGTGAATGG + Exonic
946375117 2:219303117-219303139 GGGCAAACAGGAGCAGGGGAAGG + Intronic
948880110 2:240852346-240852368 GTGCAGCCAGGATCAGAGGAAGG - Intergenic
1170851431 20:20008353-20008375 GGGCAAACAGGAGCAGCGGAGGG + Intergenic
1170871814 20:20212978-20213000 GTGCCATCAGGAGGAGAGCCCGG + Intronic
1172224515 20:33296337-33296359 ATGCAGCCAGGAGCAGGGAACGG + Intronic
1172319973 20:33988811-33988833 ATGCAATGAGGGGCGGAGAAAGG + Intergenic
1172828340 20:37809553-37809575 GTGTGATCAGGAGCTGAGGAAGG - Intronic
1173145917 20:40524222-40524244 GTGCATTCAAGAGCACAGAGAGG - Intergenic
1173365041 20:42377383-42377405 GTGCAATCAGGGGCAATGACCGG - Intronic
1173450520 20:43159563-43159585 GCGTAATGAGGAGAAGAGAAAGG - Intronic
1174029724 20:47613031-47613053 GTGCAAGAAGGAAGAGAGAATGG + Intronic
1174064196 20:47852881-47852903 GTGCCATGAGGCCCAGAGAAGGG + Intergenic
1174106869 20:48168565-48168587 GTTCAGGCAGGAGCAGAGCAGGG + Intergenic
1174132947 20:48358947-48358969 CTGCCATCAGAAGCACAGAAGGG - Intergenic
1175978347 20:62724853-62724875 GTGGAGACAGAAGCAGAGAAAGG - Intronic
1177415302 21:20785245-20785267 GTGCCATCAAGAGCACAGATAGG + Intergenic
1177839051 21:26216418-26216440 CAGCACTCAGGAACAGAGAAAGG - Intergenic
1179362132 21:40719790-40719812 GTGGGGTCAGGTGCAGAGAATGG + Intronic
1179715109 21:43282369-43282391 GACCCAGCAGGAGCAGAGAATGG + Intergenic
1181140137 22:20798351-20798373 GCCCAATCAGAAGGAGAGAAAGG + Intronic
1181434440 22:22901997-22902019 GGGAAATCAGGAGAAGTGAAGGG + Intergenic
1181508974 22:23380433-23380455 GTGGAGTCTGGAGGAGAGAATGG + Intergenic
1182153648 22:28049044-28049066 ATGCAATCAGGGGCAAAGATGGG - Intronic
1182462947 22:30495190-30495212 GTGGCACCAGGACCAGAGAAGGG - Intronic
1182985914 22:34715911-34715933 GTGCAAACAGCAGCAGCAAAAGG - Intergenic
1183644758 22:39118304-39118326 GGGCGCTTAGGAGCAGAGAAAGG - Intergenic
1184191637 22:42898873-42898895 GTGCAATCAGGAGCAGAGAAAGG + Intronic
1184259472 22:43306352-43306374 CTGCAAACAGGAACAGAGGAAGG + Intronic
1185130371 22:49035431-49035453 ATCCACTCAGGAGCAGGGAAAGG - Intergenic
950672955 3:14538102-14538124 AGTCCATCAGGAGCAGAGAAAGG + Intronic
950873363 3:16248443-16248465 GTGCAAAAAAGGGCAGAGAATGG + Intergenic
951028178 3:17851382-17851404 GTCCAAGCAAGAGCAGAGAGTGG - Intronic
951616723 3:24555659-24555681 GTGCAATAAAGAGCCTAGAAAGG - Intergenic
952385182 3:32836010-32836032 AGGCAATCAGAAGCAGAAAAAGG - Intronic
952659896 3:35833054-35833076 GTGGAATCAGGAGCCAAGAGTGG + Intergenic
953189003 3:40666016-40666038 ATGCAAGCAGGAGCAGATGATGG + Intergenic
953265722 3:41385581-41385603 GTGCAAACAGATGCAGAAAATGG + Intronic
953358204 3:42272289-42272311 GAGCAAGCAGGAGAAAAGAAGGG - Intergenic
953619795 3:44523302-44523324 CAGCACTTAGGAGCAGAGAAAGG - Intergenic
953659839 3:44883920-44883942 GAGCCCTCAGGAGCAGAGGAAGG + Intronic
953830946 3:46297244-46297266 GTACAATCATGGCCAGAGAAAGG + Intergenic
955200531 3:56848049-56848071 GTGCACTGGGGAGCAAAGAAAGG + Intronic
956469862 3:69555134-69555156 GAGGAATCAGCAGCAGAGCAAGG + Intergenic
957107811 3:75913098-75913120 GTGCCACCAGAAGCAGAAAAAGG - Intronic
957119266 3:76068676-76068698 TTGCTCTCAGGATCAGAGAAAGG - Intronic
957150454 3:76479616-76479638 GTGCAGTCAGCAGAAGATAAAGG + Intronic
958047830 3:88306028-88306050 GTAGAAACAGGAGCAGAGCAAGG - Intergenic
959286793 3:104424829-104424851 CGGCAATCAGGAGTAGAGAATGG - Intergenic
960132698 3:114074097-114074119 GTGGAATCAGGAGTAGAGAGTGG + Intronic
961082212 3:124035855-124035877 GTGCACTTAGTATCAGAGAAAGG + Intergenic
962709296 3:138071971-138071993 ATGAAATGAGGATCAGAGAAGGG + Intronic
963009444 3:140755509-140755531 GTGCAATGCAGAGCAGAGAATGG - Intergenic
964395922 3:156245701-156245723 TTGCAAACAAGAGCAGAGCATGG + Intronic
964659843 3:159107927-159107949 CTGCAAGCAGGAGCAGAGCGTGG - Intronic
966079003 3:175977156-175977178 GTGGACTCAGGAGCAGACTAGGG + Intergenic
966373081 3:179268583-179268605 GTGCATTCAGGAACACAGCAAGG + Intergenic
967081160 3:186050796-186050818 GTGCCATCAGAAGCAGCAAAGGG + Intronic
967247996 3:187507797-187507819 CAGCGCTCAGGAGCAGAGAAAGG + Intergenic
967804660 3:193704789-193704811 GTGGAATCTGGAGAAGAGACAGG - Intergenic
969423935 4:7112833-7112855 GTGGAATCAGGGGCAGAACAAGG - Intergenic
969888144 4:10235071-10235093 GGGCAATCAGGAGCACATAGGGG - Intergenic
969990382 4:11256103-11256125 GTGCAAAAAGAAGTAGAGAAAGG - Intergenic
972184200 4:36508566-36508588 GGGTACTCAGGAGCAGTGAAAGG - Intergenic
975626485 4:76354271-76354293 GTGAATTCAGGATAAGAGAAAGG + Intronic
976479584 4:85524709-85524731 CTGGAAGCAGGAGCAGAGGATGG + Intronic
977680380 4:99792338-99792360 GTGCAGAGAGGAGCAGAGGATGG + Intergenic
977987901 4:103406302-103406324 GTGAAGTCAGAAGCAGAGACTGG - Intergenic
978460542 4:108946960-108946982 GGTAAATGAGGAGCAGAGAATGG + Intronic
978652874 4:111028641-111028663 GTGCAGGGAGGAGTAGAGAATGG - Intergenic
979105246 4:116677777-116677799 ATGCAAACAGGAGCAGAGCTGGG + Intergenic
979725387 4:123954902-123954924 ATGCTATCAAGAACAGAGAAAGG - Intergenic
980300200 4:130981542-130981564 GTGAAAACAGAAGCAGAGACTGG + Intergenic
981152589 4:141396384-141396406 ATGCAAAGAGGAGAAGAGAAAGG + Intergenic
981891130 4:149738647-149738669 GTTCATAAAGGAGCAGAGAAAGG + Intergenic
982827102 4:160015378-160015400 ATGCCATCAGGAGCAGAGCAGGG + Intergenic
984638275 4:182137613-182137635 GTGCAGCCAGGAGCACAGCAGGG - Intergenic
985717725 5:1472000-1472022 GAGCACTCAGGAGCAGAGGGAGG + Intronic
985779145 5:1860787-1860809 GTGCAAACAGGATCTCAGAATGG + Intergenic
985907331 5:2850564-2850586 GTGCTCTCAGGAGCAGTGAGAGG - Intergenic
986410629 5:7475330-7475352 GTGAAGTCAGGAGCAGGGAGAGG + Intronic
987182337 5:15380851-15380873 GTGAAAGCAGGAGCAAGGAAGGG - Intergenic
987686597 5:21212151-21212173 GTGCATTGGGGAGAAGAGAAGGG + Intergenic
988053851 5:26066186-26066208 GTGCAAACAGGAGAAGAAATTGG - Intergenic
990368663 5:55094919-55094941 ATGTAATCAAAAGCAGAGAAGGG + Intergenic
990955503 5:61334320-61334342 TTGCAATCAGGAGAAAAAAATGG - Intronic
991453408 5:66777173-66777195 GTGGACTCAGGAGTACAGAATGG - Intronic
991590871 5:68250232-68250254 GTGGGAGCAGGAGCAGAGAGTGG + Intronic
992930041 5:81633875-81633897 GTGCAGTAAGGAGTAGAGAATGG - Intronic
993139874 5:84018685-84018707 TTGCTAACAGGAGTAGAGAAAGG - Intronic
995273493 5:110250533-110250555 GGCCACTCAGCAGCAGAGAAAGG + Intergenic
996003756 5:118395372-118395394 TTGCAATCTGGAGCTCAGAAAGG - Intergenic
996090428 5:119345694-119345716 GGGCTGACAGGAGCAGAGAATGG + Intronic
996709935 5:126534345-126534367 GAGCAAGAATGAGCAGAGAAAGG - Intergenic
998850005 5:146343312-146343334 GCGCACTCAGGAGGAGGGAAAGG - Intergenic
1002469526 5:179427236-179427258 CTCCAAGCAGGAGCAGAGCAGGG + Intergenic
1002976871 6:2088231-2088253 ATGCAATCAAGAGCAGAGTGTGG + Intronic
1004191367 6:13466634-13466656 GTGCCATCAGCAGCAGATCAAGG - Intronic
1004594484 6:17086246-17086268 ATGTAAACAGGAGCAGGGAAAGG - Intergenic
1004808686 6:19234208-19234230 TTGCAAATAGGAGAAGAGAATGG + Intergenic
1005832945 6:29685610-29685632 GTGAAAACAGGAGCAGAATAGGG - Intergenic
1006167910 6:32076131-32076153 GGGCAAAAAGGAGCAGGGAATGG - Intronic
1006440182 6:34049081-34049103 TTGTAAGCAGGAACAGAGAAAGG - Intronic
1007252887 6:40508383-40508405 CTGCATTCATGAGCAGAGGAAGG - Intronic
1008325855 6:50180876-50180898 GAGCAGTCAGCAGCAGAGATTGG - Intergenic
1009588806 6:65639241-65639263 GTGGAAGGAGGAGTAGAGAAAGG + Intronic
1010870760 6:81035190-81035212 GTGGAATAAGGAGGAGAGAGAGG - Intergenic
1010933820 6:81836185-81836207 GTGAAATAAGAAGCACAGAAAGG + Intergenic
1010949667 6:82020401-82020423 GTGTACTGAGGTGCAGAGAATGG - Intergenic
1011311380 6:85983457-85983479 GTGAAAGCAGGAGCAAGGAAGGG + Intergenic
1011552348 6:88541236-88541258 GGGTAATCAGGGGCAGAGCAAGG - Intergenic
1011622350 6:89255017-89255039 ATGCAGTCAGAAGCAGAGAAGGG + Intergenic
1013047023 6:106496891-106496913 GTGTAATCAGGACTAGAGCAGGG + Intergenic
1015383815 6:132599869-132599891 GTCCAGTCAGGAGAATAGAATGG + Intergenic
1015764307 6:136699630-136699652 GTGCAAACAAAAGCAGAGCAGGG + Intronic
1015920267 6:138259369-138259391 GGGAAATCAGAAGCAGAAAAGGG - Intronic
1016756518 6:147693457-147693479 GGGCAATAAGGGGCAGAGAGGGG + Intronic
1016858288 6:148693976-148693998 TTGCTATCAGGAGAAGAGCATGG - Intergenic
1017131072 6:151108720-151108742 GTGCAATTGGCAGCAGAGGAGGG + Intergenic
1018351469 6:162964114-162964136 GTGAAAGCAGAAGCAGATAATGG + Intronic
1018870460 6:167778586-167778608 GTGCATTCCTGAGCAGAGGAGGG - Intergenic
1018904788 6:168069444-168069466 GGGGAGTCAGGACCAGAGAATGG - Intronic
1020288651 7:6706177-6706199 TAGCAATCTGGAGCAGAGAGAGG + Intronic
1020747441 7:12094856-12094878 GTGCTGGCAGGAGCAGAGGAGGG + Intergenic
1021736509 7:23643593-23643615 TTCCAATTATGAGCAGAGAAAGG + Exonic
1021926009 7:25534492-25534514 CAGCAACCAGGAGGAGAGAAAGG - Intergenic
1023596145 7:41830999-41831021 GTGAAGACAGGAGCAGAGACTGG + Intergenic
1024569977 7:50715222-50715244 GCGCGATCTGGAGCAGGGAAGGG + Intronic
1026623334 7:71970725-71970747 TTTCAATAAGGAGCAGAGAAGGG + Intronic
1028492547 7:91428629-91428651 TTGCAATCAGAAACAGATAATGG + Intergenic
1028574714 7:92334822-92334844 GTGCAAACAGCAACAGAGTATGG - Intronic
1029272709 7:99386408-99386430 GTGTCAGCAGGAGCAGCGAAGGG + Intronic
1029361345 7:100090506-100090528 GTGCATGCTGGGGCAGAGAATGG + Intronic
1029889002 7:103906550-103906572 GAGGAATCATGAGCAGAGAGAGG - Intronic
1032527155 7:132587316-132587338 GTGAAAGTAGGATCAGAGAATGG + Intronic
1033118715 7:138648434-138648456 GTGCTATTATTAGCAGAGAAGGG - Intronic
1034534822 7:151720088-151720110 GTCCAATCAGAATCAGGGAAGGG + Intronic
1036982241 8:13483136-13483158 GTGAAAACAGAAGCAGAGATTGG - Intronic
1038930284 8:32186564-32186586 GTGCCACCAGCAGCAGAGAAGGG - Intronic
1039016919 8:33159954-33159976 GTGAAATCATGGGTAGAGAAGGG - Intergenic
1039928617 8:41961811-41961833 CAGTAATTAGGAGCAGAGAAAGG - Intronic
1040687069 8:49886641-49886663 GTGGAATGTGCAGCAGAGAAAGG + Intergenic
1041335043 8:56772655-56772677 TTGCAATGGGAAGCAGAGAAGGG + Intergenic
1041802467 8:61814666-61814688 GTGAAGTCAGGGGCAGAGATTGG + Intergenic
1041877446 8:62706541-62706563 GGGAAATCAGGAGCAGTAAAGGG - Intronic
1042208079 8:66348889-66348911 GTGGAATGAGGAGTAGGGAAAGG - Intergenic
1043362479 8:79491498-79491520 GTGAAATCTGGAGCAGAGTGAGG - Intergenic
1043458994 8:80440547-80440569 TTGATATCAGAAGCAGAGAAGGG + Intergenic
1044263036 8:90149840-90149862 GTTGAATCAGTAGCAGAAAATGG + Intergenic
1044319241 8:90784112-90784134 GAGCAACCAAGAGCAGAAAATGG + Intronic
1046845974 8:118916541-118916563 GTTCAAGCAGGAGGAAAGAAAGG + Intergenic
1048332134 8:133478077-133478099 GTGAAAACTGGAGCAGAGACCGG - Intronic
1048945879 8:139446679-139446701 CTGTAAACAGGAGCAGAAAATGG + Intergenic
1049129525 8:140825704-140825726 GTGGAATCCGGAGCAGTGAAAGG - Intronic
1050312966 9:4371949-4371971 GTGCAATTATGGCCAGAGAAGGG - Intergenic
1051068630 9:13135664-13135686 GAGCAATGAGGGGCAGGGAATGG - Intronic
1051973688 9:22922603-22922625 TTGCAAGAAGGAGCAGAGACTGG - Intergenic
1053473458 9:38363867-38363889 GTGCAAACAGAAGCAGAGGTTGG - Intergenic
1054888144 9:70221490-70221512 GGGGAAGCAGGAGCAGGGAATGG + Intronic
1054938582 9:70715424-70715446 GTGGAATCAGAAGTGGAGAAAGG + Intronic
1054940273 9:70733417-70733439 GTGGAATCAGAAGTGGAGAAAGG + Intronic
1056320071 9:85427531-85427553 GAGCCATCAGGAGCAGAACATGG - Intergenic
1059224584 9:112659916-112659938 GTGGTATGAGGAGCAGAGGATGG + Exonic
1059235339 9:112755951-112755973 GCGCAATCAGAATCAGAGACTGG - Intronic
1059344287 9:113617431-113617453 GTGCACTCAGAGGCAGAGAAAGG - Intergenic
1059457377 9:114408044-114408066 GAGCAAACAGAAGCTGAGAAGGG + Intronic
1060236984 9:121871526-121871548 GTCCAAGCAGGGGCAGAGCAGGG - Intronic
1060296902 9:122349100-122349122 GTGCAATCAGGACAAGCCAAAGG - Intergenic
1061993970 9:134174828-134174850 GAGAAAACAGGGGCAGAGAAGGG - Intergenic
1186321275 X:8428215-8428237 GTAGATTCAGGAGCAGAGATTGG + Intergenic
1188910309 X:35839396-35839418 ATGGAATCAGGAGAAGGGAAGGG + Intergenic
1189874905 X:45425968-45425990 GTGAAATGACGAGCAGAGAAAGG + Intergenic
1190588274 X:51968925-51968947 GAGAAATCAAGAGCAGAAAATGG - Intergenic
1192168297 X:68839616-68839638 GAGAAGTCAGGAGGAGAGAAAGG - Intronic
1192441294 X:71176336-71176358 GTGCAATCAGGAGCAATGGGTGG - Intergenic
1192565634 X:72161141-72161163 GTGCAGTGGGGAGCAAAGAAGGG - Intergenic
1193286495 X:79721177-79721199 TTGCAATCAGCACCAGGGAAAGG + Intergenic
1194244788 X:91497587-91497609 GAGCAAACAGGAGGAAAGAAAGG - Intergenic
1197042172 X:121950025-121950047 GTGAAAGCAGGAACAGAGAGGGG + Intergenic
1197585448 X:128341812-128341834 ATGCAAGCTGAAGCAGAGAAAGG + Intergenic
1198104369 X:133448388-133448410 GTGGAAACAGGAGCAGAGAGAGG + Intergenic
1198167847 X:134074728-134074750 GTGGAACCAGGAGCAGACCAGGG + Intergenic
1198487054 X:137097719-137097741 GTGGAATCTGGACCAGGGAAGGG + Intergenic
1200424940 Y:3009856-3009878 GAGCAACCAGGAGTTGAGAAAGG + Intergenic
1200563763 Y:4738896-4738918 GAGCAAACAGGAGGAAAGAAAGG - Intergenic
1201534237 Y:15028173-15028195 AAGAAATCAGGAGCAGGGAATGG + Intergenic
1201906128 Y:19087210-19087232 GTCCAATCAGGAGCAGCAATAGG - Intergenic