ID: 1184191638

View in Genome Browser
Species Human (GRCh38)
Location 22:42898874-42898896
Sequence TGCAATCAGGAGCAGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184191632_1184191638 0 Left 1184191632 22:42898851-42898873 CCATCCCTGTGCAGAAACATCCG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data
1184191634_1184191638 -5 Left 1184191634 22:42898856-42898878 CCTGTGCAGAAACATCCGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data
1184191633_1184191638 -4 Left 1184191633 22:42898855-42898877 CCCTGTGCAGAAACATCCGTGCA No data
Right 1184191638 22:42898874-42898896 TGCAATCAGGAGCAGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184191638 Original CRISPR TGCAATCAGGAGCAGAGAAA GGG Intronic
No off target data available for this crispr