ID: 1184192124

View in Genome Browser
Species Human (GRCh38)
Location 22:42901855-42901877
Sequence CGCCCTGGTGGTGCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184192124_1184192131 10 Left 1184192124 22:42901855-42901877 CCTGCAGGGGCACCACCAGGGCG 0: 1
1: 0
2: 2
3: 29
4: 242
Right 1184192131 22:42901888-42901910 GTGGTTCAGCTCGGACCAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 71
1184192124_1184192126 -9 Left 1184192124 22:42901855-42901877 CCTGCAGGGGCACCACCAGGGCG 0: 1
1: 0
2: 2
3: 29
4: 242
Right 1184192126 22:42901869-42901891 ACCAGGGCGTCTTCCTTCCGTGG 0: 1
1: 0
2: 1
3: 5
4: 74
1184192124_1184192128 1 Left 1184192124 22:42901855-42901877 CCTGCAGGGGCACCACCAGGGCG 0: 1
1: 0
2: 2
3: 29
4: 242
Right 1184192128 22:42901879-42901901 CTTCCTTCCGTGGTTCAGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 146
1184192124_1184192132 21 Left 1184192124 22:42901855-42901877 CCTGCAGGGGCACCACCAGGGCG 0: 1
1: 0
2: 2
3: 29
4: 242
Right 1184192132 22:42901899-42901921 CGGACCAGCTGGCTCGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184192124 Original CRISPR CGCCCTGGTGGTGCCCCTGC AGG (reversed) Intronic
900115503 1:1026242-1026264 CGCTCTGGTGGGGCCTCTGTGGG + Intronic
900671956 1:3859782-3859804 CCCCCTGGGGTGGCCCCTGCAGG + Intronic
901182076 1:7348579-7348601 CGCCCTGGAAGTTCTCCTGCAGG - Intronic
901686084 1:10944352-10944374 CGCACGGGTGTTGCCTCTGCTGG - Intergenic
902955601 1:19922582-19922604 CCCCATGGAGGTCCCCCTGCAGG + Intronic
904462622 1:30689252-30689274 CCTACTGGTGGTGCCCCAGCAGG - Intergenic
904612487 1:31733103-31733125 CTGCGTGGTGCTGCCCCTGCTGG - Exonic
905269614 1:36778938-36778960 TGACCTGGTGGTGTCCCTGGCGG - Intergenic
907491565 1:54811971-54811993 TGCCCTGGGAGTGCCCCTGCAGG - Intronic
907801368 1:57769059-57769081 CTCCCTGTAGGTGCTCCTGCTGG - Intronic
911092561 1:94029502-94029524 CTCCCTGGTGCTGCACCTGCAGG + Exonic
912454436 1:109788309-109788331 CGCCCTGGTGGGGCCCAGCCCGG + Intergenic
913387596 1:118276717-118276739 ACTACTGGTGGTGCCCCTGCTGG - Intergenic
913655101 1:120952754-120952776 TGCCCTGGTGGAGCCCCGGGCGG - Intergenic
914006453 1:143736428-143736450 TGCCCTGGTGGAGCCCCGGTGGG - Intergenic
914645286 1:149646914-149646936 TGCCCTGGTGGAGCCCCGGGCGG - Intergenic
919486776 1:198156817-198156839 CGCTCTGGAGGAGCCCCTCCTGG - Intergenic
919847156 1:201649367-201649389 CGAGCTGGTGGTGACCGTGCTGG + Exonic
920003153 1:202812821-202812843 GGTGCTGGTGGTGCCACTGCGGG - Intergenic
920433584 1:205934360-205934382 AGACCTGATGGAGCCCCTGCAGG - Intronic
922930150 1:229382460-229382482 CTCCCTGGGGGTCCCCTTGCTGG - Intergenic
922962572 1:229661433-229661455 CGTCCTGGTGGTGGCACTGCAGG + Intergenic
923151941 1:231241314-231241336 AGCCGTGGTGGTGCTCCTGCTGG - Exonic
923260318 1:232261862-232261884 AGCCCTGGTGCCTCCCCTGCTGG - Intergenic
924713562 1:246551561-246551583 TGCCCTGCCGTTGCCCCTGCCGG - Intronic
1067346355 10:45441612-45441634 AGACCTGGTGGTGCGCCTGGAGG - Intronic
1067731353 10:48813986-48814008 CTTCCTGGTGGTGCCTCTGCAGG - Exonic
1068813296 10:61280957-61280979 CCCACTGGTGGTGCCTCTGGTGG - Intergenic
1068940991 10:62681204-62681226 AGCACTGGTGGTTCCCATGCTGG + Intergenic
1069570536 10:69492115-69492137 CTCACTGGAGCTGCCCCTGCTGG + Intronic
1070572405 10:77650136-77650158 AGCCCAGGAGATGCCCCTGCAGG + Intergenic
1072964238 10:99957062-99957084 CGCTCTGGGAGTGCCACTGCCGG + Exonic
1073059079 10:100722761-100722783 AGTCCTGGGGGTGACCCTGCTGG - Intergenic
1073102208 10:101012213-101012235 GGACCTGGTGAGGCCCCTGCTGG - Intronic
1074928963 10:118103815-118103837 GTCCCTGGTCCTGCCCCTGCAGG - Intergenic
1076807860 10:132868070-132868092 CGCCCTGGGGCTGGGCCTGCTGG - Intronic
1076996613 11:300124-300146 GTCCCTGGGGGTTCCCCTGCCGG - Intergenic
1077096864 11:802712-802734 CACCCAGGGGGTTCCCCTGCAGG + Exonic
1077196021 11:1280634-1280656 CACCCTGGTGCTGCCTATGCGGG + Intronic
1077218077 11:1403386-1403408 TACCCTGCTGGTGCCCCTGCTGG + Intronic
1077415384 11:2422222-2422244 CAACCTGGTGGTGTCCCTGGTGG - Exonic
1077529288 11:3087701-3087723 CACCCTGGTGGGGCCACTGGTGG - Exonic
1080696051 11:34603833-34603855 AGCCCTCGTGGTGTCCCTCCTGG + Intergenic
1080869769 11:36227179-36227201 TGTGCTGGTGGTGGCCCTGCTGG + Exonic
1081775220 11:45671692-45671714 CTTCCAGGTGGTTCCCCTGCAGG + Intergenic
1081780327 11:45706189-45706211 CTGCCTGGTGGTGTCCCTGCAGG + Intergenic
1084274439 11:68044314-68044336 CGCCCTGCAGGAGGCCCTGCGGG + Exonic
1084463300 11:69308138-69308160 GGCCATGGAGATGCCCCTGCAGG - Intronic
1085032883 11:73283387-73283409 TGTCCTGGAGGTGCCCCTGCCGG + Intronic
1086953832 11:92915985-92916007 CGCCATGGGGGTGACTCTGCTGG + Intergenic
1089365526 11:117918762-117918784 CGGCCTGGAGGTGTCCCAGCTGG + Exonic
1089538417 11:119174674-119174696 CTATCTGGTGGTGCCCCTCCAGG - Exonic
1093079127 12:14789046-14789068 CGGCCTGGTGGTGGTCCTGGAGG + Exonic
1093736480 12:22625565-22625587 CCCCCAGGAGGTGACCCTGCAGG + Exonic
1095703758 12:45216558-45216580 GGCCCCGGTGCGGCCCCTGCGGG + Intronic
1102501859 12:113358669-113358691 GGCCCTGGTGCTGGCCCTGCTGG + Exonic
1102517045 12:113456693-113456715 CTCCCAGGTGATGCCACTGCTGG + Intergenic
1102787226 12:115614674-115614696 GGGCCTGGTGGTGCCTCTGTGGG + Intergenic
1103322321 12:120099358-120099380 CGCCCTGTTGGTGCCCCGGGCGG - Intronic
1103904939 12:124322357-124322379 TGCCCTGGAGCTTCCCCTGCTGG - Intergenic
1104422843 12:128651360-128651382 GGTCCTGATGGTGCTCCTGCAGG + Intronic
1104467103 12:128999553-128999575 AGCCCCAGTGGGGCCCCTGCAGG + Intergenic
1105728481 13:23188003-23188025 GGACCTGCTGGTGCCCCTGTGGG - Intronic
1106303836 13:28494048-28494070 CACCCGGGTGGGGCCTCTGCCGG - Intronic
1113885389 13:113656180-113656202 CTCCCTGGTGCTGGCCCTGCAGG + Intronic
1114656210 14:24316994-24317016 CGCCCTGGTGGGGCCCCTCTCGG + Exonic
1118355253 14:65008427-65008449 AGCCCTGGGCCTGCCCCTGCTGG + Intronic
1119910048 14:78341345-78341367 CTCCCAGGTGATGCCCATGCTGG + Intronic
1121521296 14:94587767-94587789 CGACCTGGTGGTAGACCTGCAGG + Exonic
1122353505 14:101110812-101110834 TGCCCCGCTGGTGCCTCTGCTGG + Intergenic
1122412591 14:101533584-101533606 CACCCTGGTGTACCCCCTGCTGG - Intergenic
1122624238 14:103075900-103075922 CGCCCCGGGGCTGCCCCTGTGGG + Intergenic
1122848504 14:104513782-104513804 CCCCCTGGTGGTGGCCCTTTGGG - Intronic
1122937243 14:104965940-104965962 GGCCCTGGGGGTGCCTCTGCGGG - Intronic
1122982759 14:105199010-105199032 GGCCCTGGTTGTGGCCCTGCTGG + Intergenic
1123123225 14:105927651-105927673 AGCCCTGGTGGGGACCCAGCAGG - Intronic
1123405878 15:20019151-20019173 AGCCCTGGTGGGGACCCAGCAGG - Intergenic
1123515208 15:21025799-21025821 AGCCCTGGTGGGGACCCAGCAGG - Intergenic
1125721234 15:41846088-41846110 CCCCCTGGTGCAGCCCCAGCTGG - Intronic
1125721249 15:41846133-41846155 CACCTTGGTGGTGACCCTGGAGG - Intronic
1126780952 15:52138462-52138484 CGCCCTGGTGTTGCACCCACTGG + Intronic
1129256960 15:74339131-74339153 GGCCCTGGTGGGGCCCTTGATGG - Intronic
1129723531 15:77890427-77890449 AGCACTGGTGGTGCTCCAGCGGG - Intergenic
1129845907 15:78767639-78767661 CCCCCTGCTGGTGAGCCTGCAGG - Intronic
1129895882 15:79105464-79105486 TGCCCTGGAGGTGCCCATCCAGG - Intergenic
1130909647 15:88262287-88262309 TGTCCTGGTGGGGGCCCTGCAGG + Intergenic
1132251945 15:100341230-100341252 CGCCCTGCTGCTGCACCTGCCGG - Exonic
1132330983 15:101012580-101012602 TGCCCTGATGGGGCCCCTTCTGG - Intronic
1132347017 15:101114480-101114502 CACCCTGATGGAACCCCTGCAGG - Intergenic
1135115143 16:19717852-19717874 CGTCCTGCTGGTGATCCTGCCGG - Exonic
1136429138 16:30186836-30186858 GGGCCTGATGCTGCCCCTGCGGG + Exonic
1136458954 16:30398198-30398220 CGACCTGGTGAAGCACCTGCGGG + Exonic
1137440974 16:48498293-48498315 TGCCCTGGTGGTGGCCCAGCTGG + Intergenic
1138551569 16:57751634-57751656 CGGCCTGGCTGTGCCCCTGAGGG - Exonic
1139590642 16:67931082-67931104 CCCTCTGGTGGTGTACCTGCAGG + Exonic
1141840021 16:86568217-86568239 GGGCCTGGTGGTGCCGCCGCTGG + Exonic
1142232007 16:88904444-88904466 CGACCTGGTGTTGCCCCCACAGG + Intronic
1142303936 16:89275155-89275177 CTCCCTGGCGGAGCCCCTGAAGG - Exonic
1142695212 17:1629390-1629412 CGCCCCGGTGGTTCCCGTCCCGG + Intergenic
1143509316 17:7386813-7386835 CTCCCTGCTGGAGCCACTGCTGG + Intronic
1143527706 17:7482098-7482120 TGGCCTGCTGGTGGCCCTGCTGG + Exonic
1143537236 17:7548894-7548916 CGCCCTGGTGGTGCACGCCCGGG + Exonic
1144461049 17:15458829-15458851 CTCCCTGGTGTTGCTGCTGCTGG - Intronic
1144863268 17:18319006-18319028 CACCCTGGAGGGTCCCCTGCGGG + Intronic
1145268620 17:21392535-21392557 AGCCCTGGTGGGGCTCCTGCTGG - Intronic
1146731052 17:35194172-35194194 TGGCCTGCTGGTGGCCCTGCTGG - Exonic
1148102890 17:45103470-45103492 GTCCCTGGCGGTGCCCATGCTGG + Intronic
1148151280 17:45397745-45397767 AGCCCTGGGGTTGGCCCTGCAGG - Intronic
1148790535 17:50170271-50170293 CACCCTCCTGGTGCCCCTGCTGG + Exonic
1148854582 17:50571782-50571804 GTCCCTGGTGGGGCCCCTCCGGG + Intronic
1149993123 17:61393735-61393757 CGCCCTGCAGGTGCCCTGGCAGG - Intergenic
1150085775 17:62272678-62272700 CGCCCAGGTCCTGCCCCTCCTGG - Intronic
1150437484 17:65165237-65165259 GGCCTTGGTGGTGGACCTGCAGG - Intronic
1151769859 17:76153490-76153512 TGCTCTGGAGGTGCCCCTGAGGG + Intronic
1151867879 17:76816430-76816452 CACCCAGGTGGAGTCCCTGCAGG + Intergenic
1152676819 17:81645459-81645481 GGCCCTGGTGGTGGCCCTCTGGG + Exonic
1152703149 17:81829351-81829373 CACCCTGGTGGTGGCCCAGGTGG - Intronic
1152880124 17:82809664-82809686 CAGGCTGGTGGTGCCCCTGACGG + Intronic
1152904771 17:82964533-82964555 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904797 17:82964613-82964635 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904826 17:82964695-82964717 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904841 17:82964735-82964757 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904857 17:82964776-82964798 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904885 17:82964856-82964878 CCCCGTGGGGGTGCACCTGCAGG - Intronic
1152904944 17:82965059-82965081 CCCCATGGGGGTGCACCTGCAGG - Intronic
1152904958 17:82965100-82965122 CCCCATGGGGGTGCACCTGCAGG - Intronic
1152904998 17:82965223-82965245 CCCCATGGGGGTGCACCTGCAGG - Intronic
1152905015 17:82965264-82965286 CCCCCCGGGGGTGCACCTGCAGG - Intronic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1154115449 18:11609709-11609731 TGGCCTGCTGGTGGCCCTGCTGG + Intergenic
1161046633 19:2138388-2138410 GGCCCTGGTGGTAGCCCTGAGGG - Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162329470 19:10018747-10018769 GGGCCTGGTGGGGCCCCTGGAGG + Exonic
1162345018 19:10113847-10113869 CGCCCTGACGCTGCCCCCGCTGG + Exonic
1162515069 19:11142778-11142800 CGGCCTGGTGGGGGCCCAGCAGG - Intronic
1163412335 19:17162937-17162959 CTCCCTCGGGGTGCACCTGCGGG + Intronic
1163786381 19:19277061-19277083 CACTGTGGTGGTGCCCCTACAGG + Exonic
1165244444 19:34490211-34490233 CACCCTGATGGTGCCCATGTTGG + Intronic
1165319142 19:35075101-35075123 CGCCCTGCTGGTGGCCATGTGGG + Intergenic
1166080538 19:40441572-40441594 GGCTCTGGTGGGGCCCGTGCAGG + Exonic
1166123537 19:40700212-40700234 CTCCCTTGTGGTGCCACTGCTGG + Intronic
1166351285 19:42199590-42199612 CGCCCTGCTGCAGGCCCTGCGGG - Exonic
1166979332 19:46623559-46623581 AGCCCTGGTGGCGCTTCTGCTGG + Exonic
1167660847 19:50795041-50795063 AGCTCCAGTGGTGCCCCTGCTGG + Exonic
1167667422 19:50830887-50830909 GGCCCAGGTAGTGCCCCTTCAGG - Intronic
1168638317 19:58013289-58013311 CGCCTTGGTGGCGCTCATGCTGG - Intergenic
925068853 2:950856-950878 CGCCCCGGTGGAGCCCGAGCCGG + Exonic
925175797 2:1782761-1782783 GGCCTTGCTGGGGCCCCTGCTGG + Intergenic
925761995 2:7193862-7193884 CGCGCTGGTGGGGCCTCTGGGGG + Intergenic
926218407 2:10919572-10919594 AGCCCTGCTGGGGCGCCTGCTGG + Intergenic
927180999 2:20446849-20446871 CGCGCTGCTGCTGCCGCTGCGGG - Intergenic
927342890 2:22002578-22002600 TGTCCTGGTGGTGATCCTGCTGG + Intergenic
929943577 2:46353359-46353381 GGCCCTGGACGGGCCCCTGCTGG - Intronic
932435542 2:71700824-71700846 GGCCCTGGTGGGGCCCCTTCCGG + Intergenic
934529711 2:95077239-95077261 AGCCCTGGTAGGGTCCCTGCAGG - Intergenic
936091173 2:109502187-109502209 GGCCCTGGGGGTGCCCCGGAAGG + Intronic
936937041 2:117848543-117848565 CGACCTGGTGGTGACCAGGCAGG + Intergenic
937906259 2:127054318-127054340 GGGCCTGGTGCTGGCCCTGCGGG - Intronic
938405364 2:131029907-131029929 CCCCCTCGGGGTCCCCCTGCTGG - Intronic
938936519 2:136132284-136132306 CGTCATGGTGGGGCTCCTGCAGG + Intergenic
943692448 2:190881706-190881728 CGCCCTGGTGGGGCCGCGGTGGG + Intronic
944676063 2:202034695-202034717 TGCCCTGGTGCTGGCGCTGCTGG + Exonic
947641472 2:231709819-231709841 CGCGCCCGTCGTGCCCCTGCAGG + Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
948608966 2:239154989-239155011 CGGGCTGGTGGAGACCCTGCTGG - Intronic
949044470 2:241866209-241866231 CCCCTTGCTGGTCCCCCTGCTGG + Intergenic
949044474 2:241866221-241866243 CCCCCTGCTGGTCCCCCTGCTGG + Intergenic
1169216304 20:3796528-3796550 CGCGATGGAGGTGCCCCAGCCGG + Exonic
1170999391 20:21397270-21397292 CGGCCTGGGGGCGCCCCTGGGGG - Exonic
1171187981 20:23137046-23137068 CGCCCTGGTGCAGCCCCTCCAGG - Intergenic
1171880908 20:30616900-30616922 CACCATGGTGCTGCCCCTCCTGG + Intergenic
1172012616 20:31854725-31854747 CAGCCTGGTGTTGCCCTTGCTGG + Intronic
1172033701 20:31997769-31997791 TGCCCATGTGTTGCCCCTGCTGG + Exonic
1173790182 20:45823268-45823290 CTCCCTGGTGGGGACCCGGCAGG + Exonic
1174197346 20:48782835-48782857 CTCCCTTGTGATGCCCCTCCTGG - Intronic
1175381753 20:58568597-58568619 CTCCCTGCTGGTGCTGCTGCAGG + Intergenic
1175890783 20:62314995-62315017 GGCCCTCGCGGTGCCCCTGATGG - Intronic
1175916570 20:62428641-62428663 CTCCCTGGCAGGGCCCCTGCTGG + Intergenic
1175931623 20:62496380-62496402 CTCCCTGGTTCTGGCCCTGCGGG - Intergenic
1176091916 20:63322036-63322058 AGCCCTGTTTGTGCCTCTGCAGG + Exonic
1178721501 21:35014701-35014723 CGCCCTGGCAGTGCCCATGGAGG - Intronic
1179053156 21:37906579-37906601 CTCCCTGGTGATGCTGCTGCTGG + Intronic
1179982180 21:44901329-44901351 CACCCTGCTGCTGCCCATGCAGG - Intronic
1180228301 21:46411530-46411552 CGCCCTGGAGGCGCTGCTGCAGG - Exonic
1180981418 22:19879809-19879831 CACCGTGGTGGTGACCCTGCTGG + Intronic
1181046115 22:20215086-20215108 CGCCCTGGTGGCCAGCCTGCTGG - Intergenic
1181518589 22:23432581-23432603 CGCACAGGTGGTCACCCTGCTGG - Intergenic
1181645820 22:24231456-24231478 TGCCCTGGAGGTGCCCCTGGGGG - Exonic
1182519004 22:30874826-30874848 AGCCATGGTGATGTCCCTGCGGG - Intronic
1182560174 22:31153486-31153508 TGCCCTTATGGTGGCCCTGCTGG - Intergenic
1183277822 22:36912324-36912346 AGCCCTGGAGAAGCCCCTGCAGG + Intergenic
1183343755 22:37295850-37295872 CGCCCAGGTGGTTCCCATGCAGG + Intronic
1184192124 22:42901855-42901877 CGCCCTGGTGGTGCCCCTGCAGG - Intronic
1184388462 22:44189356-44189378 CTCCCAGGTTGTACCCCTGCTGG - Intronic
1184479320 22:44737699-44737721 TGCCCTGGGGGCGCCCCTTCAGG + Intronic
952105507 3:30065412-30065434 CCACTTGGTGGTGCCCCAGCAGG + Intergenic
952902935 3:38121621-38121643 CCCACAGGTGGTGCCCCTGCGGG + Exonic
953235803 3:41104976-41104998 CACCCTGGTGATGCCATTGCTGG + Intergenic
953697419 3:45170891-45170913 AGGCCTGGGGGTACCCCTGCTGG - Intergenic
953702944 3:45210722-45210744 CCACCAGGTGGTGCCCTTGCTGG - Intergenic
953769836 3:45771571-45771593 AGCCCTAGGGGTGCCCCTGATGG - Intronic
953928926 3:46996429-46996451 CGGGCTGGTGGCCCCCCTGCAGG + Exonic
954105543 3:48407879-48407901 TACCCTGGAGGTGGCCCTGCGGG + Intronic
958904730 3:99929224-99929246 CTCCCTAGTGGTGGCCCTGTTGG + Intronic
961012924 3:123448156-123448178 CGCCCGGGTGCTGCCCCCGCTGG + Exonic
968230037 3:197000093-197000115 CTCCCAGGTGGTGCCTGTGCTGG - Intronic
968810535 4:2797760-2797782 TGCCCTGGTGGTGCCCACGTGGG + Intronic
969672803 4:8598918-8598940 CACCCTGGTGGTGTCCTTGGGGG + Intronic
970904844 4:21203615-21203637 TGCCCTGTTCTTGCCCCTGCTGG + Intronic
972425510 4:38928994-38929016 TGTCCTGGGGGTGTCCCTGCTGG + Intronic
977579091 4:98705007-98705029 CCACTAGGTGGTGCCCCTGCAGG - Intergenic
980988549 4:139718575-139718597 CCCTCTGCTGGTGCCCCTGGTGG - Exonic
982032253 4:151312575-151312597 GGTCCTGGTGATGCCACTGCTGG - Intronic
982037133 4:151356754-151356776 AGCACTGGTGCTGGCCCTGCTGG + Intergenic
985189677 4:187358875-187358897 CGTCCTGATAGTGCCCCAGCTGG + Intergenic
985576493 5:675671-675693 AGCCCTTGTTGGGCCCCTGCTGG + Intronic
985691538 5:1315465-1315487 CGCCCAGGTGGAGCCTCTGTTGG + Intergenic
988589868 5:32539375-32539397 TCCCCTGGTGGGGCCCCTGGTGG - Intronic
992095196 5:73356650-73356672 TGCCCTGGTGGTGCCCATGCAGG - Intergenic
992720496 5:79556334-79556356 CCCCCTAGTGGTTCCCCTTCTGG - Intergenic
997284696 5:132669669-132669691 TGCCATGGTGCTGTCCCTGCAGG + Intergenic
997568120 5:134905034-134905056 AGCCCTGGTAGTCTCCCTGCGGG - Intronic
1001794439 5:174490349-174490371 GGCCCTGCTGCTGCCTCTGCAGG - Intergenic
1002280548 5:178127536-178127558 CGCCCTCCTGACGCCCCTGCAGG + Intergenic
1004235870 6:13873908-13873930 CCCTCTGGTGGCGGCCCTGCTGG - Intergenic
1006056888 6:31391614-31391636 CGCCGTTGTGGAGCCTCTGCGGG + Intergenic
1006069591 6:31488515-31488537 CGCCGTTGTGGAGCCTCTGCGGG + Intergenic
1006425400 6:33960041-33960063 CCTGCTGGTGATGCCCCTGCAGG + Intergenic
1007177466 6:39906653-39906675 TGCCCTAGTGGTGGCCCAGCTGG - Exonic
1007600201 6:43076542-43076564 CGTCCTGCTGCTGCCGCTGCTGG + Intronic
1011696990 6:89921813-89921835 TGCCATGATTGTGCCCCTGCAGG + Intergenic
1016577282 6:145583895-145583917 TGCCCTGGTGGTGGCAGTGCTGG + Intronic
1016857382 6:148684556-148684578 GGCCCTGGCCCTGCCCCTGCAGG - Intergenic
1018947290 6:168356684-168356706 CTGCCTGGGGCTGCCCCTGCTGG - Intergenic
1019135389 6:169904639-169904661 CGCCTGCCTGGTGCCCCTGCAGG - Intergenic
1019351579 7:556568-556590 CTCACGGGTGGGGCCCCTGCCGG - Intronic
1019381593 7:726999-727021 CGCGCTGGCAGTGCACCTGCTGG + Exonic
1019554054 7:1619851-1619873 CGCCACGGTGGGGACCCTGCAGG - Intergenic
1019599973 7:1876363-1876385 CGCACAGGTGGTCACCCTGCCGG + Intronic
1019634416 7:2067820-2067842 CGCCGTGGTGGTGCCGCAGAAGG - Intronic
1024521193 7:50305107-50305129 CGGCCTGGTCCTGCACCTGCTGG - Intronic
1032058779 7:128706143-128706165 CAGCCTGGAGGTGCTCCTGCAGG - Intergenic
1032087287 7:128890878-128890900 CGCCCTGGCGGTGCCCCTCCCGG - Intronic
1032431724 7:131867626-131867648 CACCCCGCTGGTGCCACTGCAGG - Intergenic
1034257076 7:149730475-149730497 TGTCCTGGTGGGACCCCTGCTGG + Exonic
1034347587 7:150396937-150396959 CGCCCGTGTGGTGCCGCTGGTGG - Exonic
1034451052 7:151137493-151137515 CTCCCTGGCTGAGCCCCTGCTGG - Intronic
1035243959 7:157550472-157550494 CTCCCTGGTGGAGCCGCTGTGGG - Intronic
1036066178 8:5384034-5384056 AGCCCTGGTTGTGCCACTGTAGG - Intergenic
1036066191 8:5384108-5384130 AGCCCTGGTTGTGCGCCTGCAGG - Intergenic
1036066198 8:5384145-5384167 AGCCCTGGTTGTGCCACTGCAGG - Intergenic
1036066213 8:5384219-5384241 AGCCCCGGTTGTGCACCTGCAGG - Intergenic
1036066250 8:5384404-5384426 AGCCATGGTTGTGCCACTGCAGG - Intergenic
1036737483 8:11331220-11331242 TGGCCTGCTGGTGGCCCTGCTGG + Exonic
1048203896 8:132400527-132400549 GGCCCTGGTGATGCCACCGCGGG + Intronic
1048974609 8:139664138-139664160 AGCCCTGGTTCTGCCCCTCCCGG - Intronic
1049478361 8:142807308-142807330 TGCCCTAGAGGTGCCCCTGAGGG + Intergenic
1049510632 8:143025078-143025100 CGCCCTGGCACTGCCCCTGGTGG - Intergenic
1049511192 8:143027352-143027374 CCCCCTGGCGCTGCCCCTTCAGG - Intergenic
1049720728 8:144114313-144114335 CTCGCTGTTGGTGGCCCTGCTGG + Exonic
1049755920 8:144311270-144311292 GGCCCTTGTGGGGCCCCCGCCGG - Intronic
1055090980 9:72364785-72364807 CGCCCTGGTGCCGCCGCCGCGGG + Intronic
1057623224 9:96655089-96655111 CGCCGTGGTGGTGTTCGTGCGGG - Exonic
1057957982 9:99426658-99426680 AGCTCTTGAGGTGCCCCTGCTGG - Intergenic
1061582430 9:131546042-131546064 AGCTCTGGGGGCGCCCCTGCGGG + Intergenic
1061886121 9:133591858-133591880 CGCTCTGGGGATGCACCTGCTGG + Intergenic
1189801807 X:44698504-44698526 TGTCCTGGGGGTGCCCTTGCTGG - Intergenic
1190298047 X:49040041-49040063 AGCCCTTGAGGAGCCCCTGCTGG - Intronic
1192238216 X:69309697-69309719 GGCCATGGTGGAGGCCCTGCAGG - Intergenic
1193130074 X:77910595-77910617 CTTCCGGGTGATGCCCCTGCCGG - Intergenic
1197301672 X:124788896-124788918 CCACTTGGTGGTGCCCCAGCAGG + Intronic
1197754572 X:129984513-129984535 CGGCCTCTTGGCGCCCCTGCAGG - Intronic
1198026001 X:132707822-132707844 CTCCCAGATGATGCCCCTGCAGG - Intronic
1199336043 X:146620072-146620094 CTCCCTGGCGGAGCCCCTGAAGG - Intergenic