ID: 1184192603

View in Genome Browser
Species Human (GRCh38)
Location 22:42904809-42904831
Sequence CAGTCCCCACTAGTGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184192598_1184192603 -10 Left 1184192598 22:42904796-42904818 CCTGTTACCCTACCAGTCCCCAC No data
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192595_1184192603 16 Left 1184192595 22:42904770-42904792 CCCGAATCCTGGTTTACTTTATG 0: 1
1: 0
2: 1
3: 22
4: 148
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192591_1184192603 25 Left 1184192591 22:42904761-42904783 CCCCCTGCACCCGAATCCTGGTT 0: 1
1: 0
2: 0
3: 15
4: 118
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192594_1184192603 22 Left 1184192594 22:42904764-42904786 CCTGCACCCGAATCCTGGTTTAC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192596_1184192603 15 Left 1184192596 22:42904771-42904793 CCGAATCCTGGTTTACTTTATGA 0: 1
1: 0
2: 2
3: 11
4: 170
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192589_1184192603 30 Left 1184192589 22:42904756-42904778 CCTAGCCCCCTGCACCCGAATCC No data
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192592_1184192603 24 Left 1184192592 22:42904762-42904784 CCCCTGCACCCGAATCCTGGTTT 0: 1
1: 1
2: 0
3: 16
4: 162
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192597_1184192603 9 Left 1184192597 22:42904777-42904799 CCTGGTTTACTTTATGACTCCTG 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118
1184192593_1184192603 23 Left 1184192593 22:42904763-42904785 CCCTGCACCCGAATCCTGGTTTA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184192603 Original CRISPR CAGTCCCCACTAGTGGAATG TGG Intronic
900186942 1:1337122-1337144 CAGTCCCCACTGGTGGCGGGTGG - Intronic
905530454 1:38674613-38674635 CTGTCCCCACTAATAAAATGTGG - Intergenic
911333299 1:96550387-96550409 CAATTCCCACAAGTGTAATGTGG + Intergenic
913502368 1:119483062-119483084 CATTCCCGACTGCTGGAATGAGG + Intergenic
915216451 1:154343770-154343792 CAGTCCCTAACTGTGGAATGTGG + Intronic
915401642 1:155626224-155626246 GAGTCCTTACTAGTGGGATGGGG + Intergenic
921880533 1:220250028-220250050 GAGTCCCCACTAGGGCACTGTGG + Intronic
924708534 1:246516908-246516930 CAGTCAGCACTCGTGGAAGGAGG + Intergenic
1063755802 10:9006722-9006744 CATTCCCCACTAGTGAAAAAAGG + Intergenic
1070397773 10:76026636-76026658 CAGTCCCAGCTAGAAGAATGAGG + Intronic
1075591348 10:123693729-123693751 CACTCCGCATTTGTGGAATGAGG - Exonic
1080680872 11:34474781-34474803 CAGTCCTCACTAGAGGACTGTGG + Intergenic
1083040455 11:59680517-59680539 CAATCCCCACATGTGGAAAGAGG - Intergenic
1085619093 11:78023779-78023801 GAGTTCCCAGTAGTGAAATGGGG + Intronic
1086621018 11:88886987-88887009 CAGCCCCACCTAGTGGAATAGGG + Intronic
1088704285 11:112447921-112447943 CAGTCCCTCCGACTGGAATGGGG - Intergenic
1091295761 11:134473004-134473026 CTGTCCCTCCTAGTGGAGTGGGG - Intergenic
1096153148 12:49327087-49327109 CTGTCCCTAATAGTGCAATGGGG + Intronic
1096814414 12:54192762-54192784 AAGTCCCCACAGATGGAATGGGG - Intergenic
1101498682 12:105280503-105280525 CAGTCCCCAGAGGTGGGATGTGG - Intronic
1103736002 12:123061248-123061270 AAGACCCTGCTAGTGGAATGGGG + Intronic
1110008187 13:70297692-70297714 CAGTCCCCCAGACTGGAATGGGG + Intergenic
1111011841 13:82324546-82324568 CAGTACCATCTAGTGGAATAGGG + Intergenic
1112154543 13:96803147-96803169 CAGCCTCCACTGGGGGAATGAGG - Intronic
1117432502 14:55682308-55682330 CACTCCCCACAAATGGAAAGCGG - Intronic
1118072162 14:62257183-62257205 CAAGCCCCACTGGTGGAATGTGG + Intergenic
1120324519 14:83008113-83008135 CAGTACACACTAGTGTAATTGGG - Intergenic
1123205855 14:106712859-106712881 CAGTTCTCATCAGTGGAATGTGG - Intergenic
1124984865 15:34597782-34597804 CAGTCCCCAATGATGGAGTGTGG + Intergenic
1127162329 15:56202441-56202463 CAGTAGCCACTAGTTGCATGTGG - Intronic
1127301948 15:57663418-57663440 GAAGCCCCACTAGGGGAATGGGG + Intronic
1132289399 15:100688918-100688940 CTCTCCCCAGTAGTGGAATGCGG + Intergenic
1135435829 16:22426029-22426051 CAGTCACCAATAGTGGAGTTGGG - Intronic
1137332192 16:47509547-47509569 CAGTACCCACTAGTGACATGTGG + Intronic
1137428838 16:48402001-48402023 CAGTAACCACTAGTTAAATGTGG - Intronic
1137599937 16:49749775-49749797 CAGGCCCCAGTAGTGAATTGGGG + Intronic
1139901953 16:70335112-70335134 GAGTACCCACCAGGGGAATGTGG - Exonic
1143789981 17:9287067-9287089 CATTCCCCACTAGTAGAGTTTGG - Intronic
1144740092 17:17576919-17576941 CAATCCGCTCTACTGGAATGTGG - Exonic
1144841918 17:18192037-18192059 CATTCCACACTGGGGGAATGGGG - Intronic
1146718475 17:35106118-35106140 CATTCCCCACTAGGTGAGTGAGG - Intronic
1153535458 18:6097542-6097564 CTGTCCCAACTGGTGGAATCAGG - Intronic
1160856704 19:1221048-1221070 TAGCCTCCACTAGTGGAAGGTGG + Intronic
1162567832 19:11454004-11454026 CAGTGCCCCCTGGTGGAATGCGG - Exonic
1163779519 19:19239268-19239290 GAGTCCCCACTTGTGGAGGGTGG + Intronic
1165088069 19:33365040-33365062 CAGTCACCGCTCGTGGACTGAGG + Intergenic
1168434894 19:56309111-56309133 CAGCCCCCAAAAGAGGAATGGGG + Intronic
930090122 2:47525774-47525796 CAGTGCCCACTCAGGGAATGGGG + Intronic
936238690 2:110768640-110768662 CAGTGCCCACTACTGGGGTGAGG - Intronic
936555579 2:113496290-113496312 CAGCCCACACTAAAGGAATGGGG + Intergenic
941561017 2:167044410-167044432 CAGTCCTCACTAGAGCAATCAGG + Intronic
943337762 2:186639577-186639599 CACTTCCCAATAGTGGAAGGAGG - Intronic
948174270 2:235930868-235930890 CAGTGCCGACCAGTGGAGTGAGG + Exonic
948644006 2:239392621-239392643 CAGCCCCCAGAGGTGGAATGGGG + Intronic
948976857 2:241468710-241468732 CAGCCCCCACAAGTGCACTGGGG + Intronic
1169690663 20:8327334-8327356 CCCTCCCCACAACTGGAATGAGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1171413327 20:24960783-24960805 CAGTTCCCATTGGTGCAATGAGG + Intergenic
1172009841 20:31840219-31840241 CAGTCCCCAGGACTGGTATGTGG - Intergenic
1173137222 20:40449109-40449131 CTGTCCCCACTAGTGAAATTTGG - Intergenic
1173169435 20:40711943-40711965 CACTCCTCACTAGGAGAATGTGG + Intergenic
1175867257 20:62185783-62185805 CAGTCCCCACTGGCCAAATGTGG - Intronic
1176728903 21:10469832-10469854 CATTCCCCACTAAAGGAATCTGG - Intergenic
1178403024 21:32303515-32303537 GGGTCCACACTGGTGGAATGAGG - Intronic
1181115053 22:20627061-20627083 CAGTCCCCAGGAGGGGAATGTGG + Intergenic
1181274882 22:21682016-21682038 CAGTCCTCGTTAGTGGAGTGAGG + Intronic
1183625211 22:38997568-38997590 CAGTGCCCACAAGTGGATAGAGG + Intergenic
1184192603 22:42904809-42904831 CAGTCCCCACTAGTGGAATGTGG + Intronic
1184943050 22:47782770-47782792 CTGGCCTCACTATTGGAATGAGG + Intergenic
950109771 3:10411575-10411597 CAGTACCCTCTACTGTAATGCGG + Intronic
950930620 3:16785233-16785255 GAGTCCTCACTAGGGGAAGGTGG + Intergenic
951057035 3:18159401-18159423 CACTTCCACCTAGTGGAATGGGG + Intronic
953430080 3:42832103-42832125 CAGTTGCCACTAGAGGAAAGGGG - Intronic
955529947 3:59862699-59862721 AAATCACCACTAGTGGAGTGAGG + Intronic
958544015 3:95517221-95517243 CATTCTCCACTTGAGGAATGAGG - Intergenic
958842110 3:99218671-99218693 CAGTGCCCACTAGTGAAAGATGG + Intergenic
961651035 3:128416753-128416775 CTGTCCCCACGAAGGGAATGAGG + Intergenic
968282050 3:197484642-197484664 CAGTCCCCACTTTGGAAATGGGG - Intergenic
975486656 4:74941139-74941161 GGTTCCCCACTAGTTGAATGTGG - Intronic
978983800 4:114983808-114983830 TAATCCCCACATGTGGAATGTGG + Intronic
984502422 4:180572900-180572922 CATTGCCCACTTGTGGTATGTGG - Intergenic
986267091 5:6200302-6200324 CAGTCTTCACTAGGGGAAAGAGG - Intergenic
987664066 5:20913311-20913333 CAGTGCCCACTAGTGAATTCAGG + Intergenic
987927731 5:24364308-24364330 AAGTCCCATCTGGTGGAATGCGG - Intergenic
988758621 5:34288880-34288902 CAGTGCCCACTAGTGAATTCAGG - Intergenic
1003247828 6:4399308-4399330 CAGTCCCCACTGCTGTCATGAGG + Intergenic
1004340840 6:14806115-14806137 CAGTCCGTATTTGTGGAATGAGG - Intergenic
1006597153 6:35201859-35201881 CAGCCCCCAAGAGTGGAATTAGG + Intergenic
1007623598 6:43229544-43229566 GAGTCCACACCTGTGGAATGGGG + Intergenic
1011626522 6:89287659-89287681 AAGTCCTCACCTGTGGAATGGGG - Intronic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1014325300 6:119986328-119986350 CAGTCCCCACTTGTGGGGTGAGG - Intergenic
1015664859 6:135617402-135617424 CAGTCCTCACCAGAGGACTGTGG - Intergenic
1018012312 6:159682615-159682637 CAATCCCCAGCAGTGGAATAAGG + Exonic
1019258320 7:65618-65640 CTGTCCCCACCTGAGGAATGGGG - Intergenic
1022262438 7:28719432-28719454 CTGTCCCCACTTTTTGAATGAGG + Intronic
1023375097 7:39548028-39548050 GAGTCCTCACTGGTGCAATGTGG - Intergenic
1023985530 7:45092387-45092409 TAGCCCCCACTTGTGGAAAGTGG + Intergenic
1034601195 7:152258090-152258112 CATTCCCCACTAAAGGAATCTGG + Intronic
1035020071 7:155795740-155795762 CAGGACCCACTAGTGGGTTGTGG - Intergenic
1035764103 8:2091868-2091890 CAGGCCCCACTAGTGGACTGCGG - Intronic
1037309108 8:17536196-17536218 CAATGCCCACTGTTGGAATGAGG - Intronic
1038444291 8:27592844-27592866 CAATCCCCACTAGTCAAGTGAGG - Intergenic
1040777954 8:51070363-51070385 GCGTCCCGAATAGTGGAATGTGG + Intergenic
1041015154 8:53585622-53585644 CATTACCCACTGGTGGTATGAGG - Intergenic
1042024292 8:64405916-64405938 CAGTCCCAACTAGAGGAACCAGG + Intergenic
1044792729 8:95864466-95864488 AAGACCCCACTATTGGGATGGGG - Intergenic
1048052183 8:130828530-130828552 CAGTGCCACCTAGTGGAATAGGG + Intronic
1048354580 8:133642784-133642806 CAGGCCCCACCTGTGGAAGGCGG + Intergenic
1048598767 8:135896053-135896075 CAGCCTCCTCTAGTGGAATCAGG + Intergenic
1049055565 8:140233990-140234012 CAGTAGCCACTAGAGAAATGTGG + Intronic
1049897414 9:120898-120920 CAGCCCACACTAAAGGAATGGGG - Intergenic
1053740510 9:41131165-41131187 CAGCCCACACTAAAGGAATGGGG - Intergenic
1054443503 9:65287340-65287362 CAGCCCACACTAAAGGAATGGGG - Intergenic
1054486773 9:65734163-65734185 CAGCCCACACTAAAGGAATGGGG + Intergenic
1054687840 9:68300134-68300156 CAGCCCACACTAAAGGAATGGGG + Intergenic
1055660589 9:78500056-78500078 TAGTCCCCACTGATGGGATGGGG + Intergenic
1058144835 9:101399318-101399340 AACTCCCCACTAGTGCATTGGGG + Intronic
1061755388 9:132808876-132808898 CAGTACCCACCAGGGCAATGAGG + Intronic
1062583277 9:137237566-137237588 CAGACCCCACTAGGGGATAGAGG + Intergenic
1203585344 Un_KI270746v1:64235-64257 CATTCCCCACTAAAGGAATCTGG + Intergenic
1186501070 X:10050838-10050860 AAATCCCCACTAGTGGCTTGTGG + Intronic
1187003578 X:15207897-15207919 CAGTAGCCACTAGTGACATGTGG - Intergenic
1187345339 X:18458793-18458815 CAGTAGCCACTAGTCAAATGTGG - Intronic
1187753577 X:22495118-22495140 GAGTCTCCAAGAGTGGAATGTGG - Intergenic
1188128394 X:26399597-26399619 CAGTCCCCACTAGGGCAATGTGG + Intergenic
1188294740 X:28433484-28433506 CAGTACCCACTGGGGTAATGTGG - Intergenic
1199679338 X:150214661-150214683 CAGTCCCCACTAAGGGCAAGTGG - Intergenic
1199695889 X:150342388-150342410 CAGTCCCCACTAAGGGCAAGTGG + Intergenic