ID: 1184192916

View in Genome Browser
Species Human (GRCh38)
Location 22:42907039-42907061
Sequence CCTTCCTAGGGAGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184192916_1184192922 -9 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192922 22:42907053-42907075 CTAGGAAGGAGATGGAAGTCTGG No data
1184192916_1184192928 28 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192928 22:42907090-42907112 CCTCCAAGCCACACCAGGCAGGG No data
1184192916_1184192926 27 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192926 22:42907089-42907111 TCCTCCAAGCCACACCAGGCAGG No data
1184192916_1184192923 -5 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192923 22:42907057-42907079 GAAGGAGATGGAAGTCTGGATGG No data
1184192916_1184192924 -2 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192924 22:42907060-42907082 GGAGATGGAAGTCTGGATGGAGG No data
1184192916_1184192925 23 Left 1184192916 22:42907039-42907061 CCCAGAGCAGCTCCCTAGGAAGG No data
Right 1184192925 22:42907085-42907107 AGAATCCTCCAAGCCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184192916 Original CRISPR CCTTCCTAGGGAGCTGCTCT GGG (reversed) Intronic