ID: 1184198325

View in Genome Browser
Species Human (GRCh38)
Location 22:42947172-42947194
Sequence CAGGAGGCTGCCCTTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184198320_1184198325 13 Left 1184198320 22:42947136-42947158 CCTGGCATAAATAGAAGGAAAAA 0: 1
1: 1
2: 7
3: 37
4: 626
Right 1184198325 22:42947172-42947194 CAGGAGGCTGCCCTTTGTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184198325 Original CRISPR CAGGAGGCTGCCCTTTGTTC AGG Intronic
901041997 1:6369805-6369827 CAGGTGGATTGCCTTTGTTCAGG - Intronic
901147125 1:7072812-7072834 CAGGAGCCTGCTGTCTGTTCAGG + Intronic
903194785 1:21677402-21677424 CAAGAGTCTGCCCTTGGCTCAGG - Intergenic
903627703 1:24743393-24743415 CAGGAGGCTCCCCTTAGATGGGG - Intergenic
903666285 1:25009498-25009520 CAGGAGGCTGCCCACTGCTGAGG - Intergenic
904058640 1:27688770-27688792 CAGGAGGCTCCCCTTAAATCCGG + Intergenic
905463788 1:38137892-38137914 AACAACGCTGCCCTTTGTTCTGG - Intergenic
905858516 1:41330696-41330718 GAGCAGGCAGCCCTCTGTTCTGG - Intergenic
906063378 1:42962640-42962662 CTGGAGGCTGCCTTTAGTCCTGG + Intergenic
906191514 1:43902250-43902272 CAGGAGGCAGCTCTGTGTTCTGG + Intronic
906505168 1:46373624-46373646 CTGGAGGCTGCCCTCAGATCAGG + Intergenic
910359069 1:86396358-86396380 CAGCAGGCTGCCGATTGGTCCGG + Intergenic
912493154 1:110073493-110073515 CAGGAGGGAGCCATTTGTTCAGG + Intronic
912578039 1:110693575-110693597 CAGAAGGCTGCCTTTTCTTAGGG - Intergenic
915474258 1:156143820-156143842 AAGGAGACTGCCCTTTGTCAAGG + Intergenic
916607375 1:166356322-166356344 TAAGAGGCTGCCATTTGTTGAGG + Intergenic
920725037 1:208427117-208427139 CAGTAGGATGCCCATTGTTATGG + Intergenic
921173165 1:212566786-212566808 CAGGAGGCTGCTCAATTTTCAGG - Intronic
922494266 1:226043579-226043601 CAGGCTGTTGCCCTTTGTTATGG - Intergenic
922792153 1:228316539-228316561 CAGGAGGCTGGGCTGTCTTCTGG + Intronic
922860244 1:228810331-228810353 CAGGAGGCTGACCTGGTTTCGGG + Intergenic
922984258 1:229853774-229853796 CAGCAGGATGCCCATTGCTCTGG + Intergenic
923063299 1:230496612-230496634 AAGGAGGCTTCCCTTTGTTTTGG + Intergenic
924942745 1:248823845-248823867 CTTGAGTCTGCCATTTGTTCCGG - Intronic
1062931426 10:1355031-1355053 CACGAGGCTCCCATGTGTTCAGG + Intronic
1063374582 10:5546425-5546447 CAGGAGGGTGTCCTTGGCTCTGG - Intergenic
1065843128 10:29722008-29722030 CAGGCGGATGACCTTTGGTCAGG + Intronic
1069373988 10:67775340-67775362 AAGGGGTCAGCCCTTTGTTCAGG + Intergenic
1073593988 10:104782370-104782392 CAGTGGTCTGCCCTTTGTTGAGG + Intronic
1075210842 10:120489785-120489807 CAGCAGGCTGCAATTAGTTCAGG + Intronic
1075540336 10:123307487-123307509 CAGGAGGCTGCCCTTAGGAAAGG - Intergenic
1076164479 10:128270504-128270526 CAGGAGGCTGACCAGAGTTCAGG - Intergenic
1076294583 10:129374678-129374700 CAGGAGGCTGCTCTTTCTCTTGG - Intergenic
1076349663 10:129807335-129807357 CAGGAGGCTTCCTTATGTTCTGG + Intergenic
1076853837 10:133105753-133105775 CAGGAACCTGCCCTCTGGTCAGG + Intronic
1079312929 11:19382075-19382097 CAGGGGGCTGCCTTATGTGCTGG + Intronic
1081197865 11:40183514-40183536 CAGGAGGCTGACCACTGTTCCGG + Intronic
1081655550 11:44854698-44854720 CAGGATGCTGACCTGTGTGCAGG + Intronic
1083154189 11:60812499-60812521 CAGGGGGGTGCCCTTAGTTAGGG + Intergenic
1083339761 11:61951564-61951586 CCAGAGGCTGCCCTTTGCTTTGG - Intronic
1084089059 11:66868587-66868609 CAGGACGCTGCCGATTGCTCAGG - Intronic
1084651428 11:70491712-70491734 CAGGAGGCCACGCCTTGTTCAGG + Intronic
1088585580 11:111357644-111357666 GAGGAGGCTGCCCTGTGTGCCGG - Exonic
1088611356 11:111580370-111580392 CACAAGGCTGCCCTTGCTTCTGG - Intergenic
1089075329 11:115733959-115733981 CAGGATGTGGCCCTTTGTTATGG - Intergenic
1089364164 11:117910849-117910871 AAGGAAGCTACCCTTTGTACAGG + Intronic
1091387757 12:105392-105414 CAGGATGCTCCCCTCTGTGCAGG - Intronic
1091796131 12:3298376-3298398 CGGGAAGCTGCCCTTTCTCCAGG - Intergenic
1092050307 12:5464900-5464922 AATGAGGCTGCCAGTTGTTCAGG - Intronic
1092513588 12:9184505-9184527 CAGGTTGCTGGCCTTTGTGCAGG - Intronic
1092727550 12:11500126-11500148 CAGGGGGCGGCCCTCTGATCAGG - Intronic
1094496334 12:30991730-30991752 CAGGAATCTGCCCTTTGCCCAGG + Intronic
1098206796 12:68119107-68119129 CAGGTGGCTGATCTCTGTTCAGG - Intergenic
1098845236 12:75526861-75526883 CAGGAGGCTGCAATTAGGTCGGG - Intergenic
1101055384 12:100907120-100907142 CACAAGGCTGCACTTTCTTCGGG - Intronic
1101484285 12:105136604-105136626 AAGGAGGCTTCCCTTTTTTAGGG - Intronic
1102198555 12:111041858-111041880 CAGGAGCCTTTCATTTGTTCTGG - Intronic
1104908725 12:132229345-132229367 CTGGAGGCTGCTCTGGGTTCAGG - Intronic
1106551257 13:30773174-30773196 AAGGAGGCTGCCTTTTATTTGGG + Intergenic
1107716096 13:43200900-43200922 CAGGAAGCTGGCTTTAGTTCTGG - Intergenic
1107958587 13:45540300-45540322 CAGGAGGAGGCGCTGTGTTCTGG + Intronic
1108258512 13:48633347-48633369 CAGTATGGTTCCCTTTGTTCAGG + Intergenic
1108323074 13:49305440-49305462 AAGGCGGCTGGCCTTTATTCAGG - Intergenic
1112335253 13:98509892-98509914 CAGGAGGCAGTCCTCTGTCCTGG - Intronic
1112514383 13:100039321-100039343 TAGGGGGCTGCCCTGTGTACTGG - Intergenic
1112825726 13:103390794-103390816 TACTAGGCTGCCCTTTGTCCTGG + Intergenic
1113038092 13:106073425-106073447 CAGGAGGCTGCCCCTGGTCTCGG - Intergenic
1113430061 13:110242025-110242047 CAGGATGCTGCACTGTTTTCTGG + Intronic
1113455417 13:110445383-110445405 CTGGAGGCTGCCCTAGGTGCAGG - Intronic
1113758615 13:112832242-112832264 CCCGAGGCTGCCCTGTGTGCGGG - Intronic
1114715057 14:24816172-24816194 CAGGACTCTGCCATGTGTTCTGG + Intronic
1119335654 14:73831387-73831409 CAGGGGGCTTCCCTTTAATCAGG - Intergenic
1119651482 14:76387067-76387089 CAGGAGGCTGACCCTTGTGAGGG + Intronic
1119987213 14:79151365-79151387 CTGGAGGCTCACCTCTGTTCTGG - Intronic
1120830762 14:88995616-88995638 CATGATGCTGCCCTTTGCCCTGG + Intergenic
1121113678 14:91329324-91329346 CAGAAGACTTCCCTGTGTTCAGG + Intronic
1122666243 14:103332606-103332628 TAAGGGGCTGCCCTTTGTTTTGG - Intergenic
1123118883 14:105908008-105908030 CAGGAGGCTGCCCTGTAACCGGG + Intergenic
1125030483 15:35071028-35071050 AAGCAGACTGCCCTTTGCTCTGG + Intergenic
1125768676 15:42151199-42151221 CAGTAGGCTGCAAGTTGTTCTGG + Intronic
1127509188 15:59623515-59623537 CAGGAGGTTGACCTGGGTTCAGG - Intronic
1128185800 15:65642543-65642565 CAGGAGGGCTCCCTTGGTTCTGG - Intronic
1128268893 15:66291811-66291833 CAGGAGGCTGTCCCTAATTCAGG - Intergenic
1130027889 15:80285585-80285607 CTGGAGCCTGCCCCTTGTGCAGG - Intergenic
1131323789 15:91422886-91422908 ATGGAGGCTTCCCTCTGTTCAGG - Intergenic
1131337919 15:91567781-91567803 CAGGTGGCTGCCCTTGGCCCAGG - Intergenic
1132179987 15:99744999-99745021 CCGGTGGCTTCCCTCTGTTCCGG - Intergenic
1132731824 16:1366601-1366623 CAGGAGGCTGTCCTCTGCCCAGG - Intronic
1133281398 16:4667384-4667406 CAGAAGGCTGCCCTCTGCCCAGG - Intronic
1133292977 16:4734853-4734875 CACGAGGCTGCCGGTTGTTATGG - Intronic
1134881522 16:17748526-17748548 CAGCATGCTCCCCTTTGTTATGG - Intergenic
1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG + Intronic
1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG + Intergenic
1136489709 16:30598895-30598917 AAGGAAGCTGCTCTTTGTCCTGG + Intergenic
1141990007 16:87603919-87603941 CTGGAGGCCGCCCTTCGATCAGG + Intronic
1144377339 17:14657423-14657445 CCTGAAGCTGCCCTTTGATCTGG - Intergenic
1145935880 17:28714523-28714545 CAAGAGGCAGCTCTTTGGTCTGG + Exonic
1151448868 17:74185253-74185275 CAAGGGGCTGCCCTTTATGCTGG - Intergenic
1152202936 17:78957622-78957644 CAGGAGGCTGCTCAGGGTTCCGG - Intergenic
1152354512 17:79800229-79800251 CGGGAGGAAGCCCTGTGTTCCGG + Intronic
1155272371 18:24153182-24153204 CAGGAGGTTCCCTGTTGTTCTGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156449163 18:37256993-37257015 CAGGAGTCTGTCCTTTTTTCAGG + Intronic
1158437312 18:57442595-57442617 CAGGTGGTTTCCCTTTGGTCTGG + Intronic
1160134309 18:76259496-76259518 CAGCAGGCTGGCCTCTGTCCTGG - Intronic
1161704506 19:5812822-5812844 CAGGAGGCTGCCCTAGGAACAGG + Intergenic
1163301070 19:16446711-16446733 CATGAGGCTGTCCTGTGGTCCGG - Intronic
1164428520 19:28166503-28166525 CAAGAGTCTGGCCTTTGCTCTGG - Intergenic
1165289117 19:34868876-34868898 CAGGAGGCTCTTCCTTGTTCTGG - Intergenic
925740937 2:7005609-7005631 CAGGAAGCTGTTCTGTGTTCTGG - Intronic
926230815 2:11002611-11002633 CAGGAGTCTTCCCTCTGTGCTGG - Intergenic
927113924 2:19883786-19883808 CAGGAGGGTGCCATCTGGTCAGG - Intergenic
927495550 2:23549433-23549455 CAACAGGCTGCCCTCTGGTCTGG + Intronic
928015752 2:27655454-27655476 CTGGAGGCTGACCTTGCTTCTGG - Exonic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
931183907 2:59931032-59931054 CAGGAGGCTGACCCTGGCTCCGG - Intergenic
934478041 2:94605843-94605865 GAGGAGGCTGGGCTTCGTTCTGG + Intergenic
935470494 2:103453599-103453621 CAGAAGACTGCCTTTTGTTAGGG - Intergenic
936042626 2:109161370-109161392 CAGGAGGCTGCCCCTCTTCCTGG - Intronic
937913701 2:127088643-127088665 CAGGAGGATGCCTTGAGTTCAGG + Intronic
942070690 2:172312918-172312940 CTGAAGTCTGCCCTTTGTTCTGG - Intergenic
944093129 2:195935871-195935893 AAGGAGGCTGCCCCTTTTACCGG + Intronic
947909548 2:233792113-233792135 AAGGAGGCTGGCCTGTGTCCGGG + Intronic
948067513 2:235092218-235092240 CTGAAGGCTGCCCTCTGTCCCGG - Intergenic
948454298 2:238097606-238097628 CAGGATGGGGCCCTTTGTTGGGG + Intronic
1170668953 20:18412618-18412640 GGGGAGGATGCCCTTTCTTCTGG - Intronic
1171437874 20:25137007-25137029 CAGGTGGCTGCCAATGGTTCTGG - Intergenic
1172811188 20:37649514-37649536 CAGGAGGGGACCCTTTGATCTGG + Intergenic
1172838264 20:37886746-37886768 CTCAAGGCTGCCCTTTCTTCTGG + Intergenic
1174090288 20:48041556-48041578 CAGGAGGGAGCCCTCTGTGCTGG - Intergenic
1178935878 21:36861264-36861286 CAAGAGACTGCCCTTTGCCCAGG + Intronic
1179553622 21:42159112-42159134 CAGGAGGCTGTCCTGGCTTCTGG + Intergenic
1180169201 21:46049139-46049161 CAGGGGGCTGCCCCTTGAGCTGG - Intergenic
1181379285 22:22487209-22487231 CAGGAGGCTCCCCTAAGGTCAGG + Exonic
1181419676 22:22789063-22789085 CACGAGGCTGTCCTTGGCTCAGG + Intronic
1182566367 22:31203015-31203037 CAGGAATTTGCCCTTTCTTCAGG - Intronic
1182619921 22:31613362-31613384 CACGTGGCTGGCCTTTGTACTGG + Exonic
1182903270 22:33916734-33916756 CAGGAGGCTGGCCTTCCTTACGG - Intronic
1184198325 22:42947172-42947194 CAGGAGGCTGCCCTTTGTTCAGG + Intronic
949218359 3:1599895-1599917 CAGCAGTCTGCCCATTGGTCTGG - Intergenic
950592741 3:13950457-13950479 AAGGTAGCTTCCCTTTGTTCTGG + Intronic
950626045 3:14247819-14247841 CAGCAGGCTGCCCCTGCTTCTGG - Intergenic
954454116 3:50587829-50587851 CAGGAGGCTGCAACTTGTCCAGG + Intergenic
956830253 3:73039710-73039732 CAGGAGGATGTCCTTTGTACTGG - Intronic
961869398 3:129976877-129976899 CAGGATGCTGCCGCTTGTGCTGG - Exonic
962588251 3:136863062-136863084 CAGGAAGCTGGGTTTTGTTCAGG + Intronic
964503966 3:157378236-157378258 CTGGATGCTGCCATGTGTTCAGG + Intronic
967006888 3:185392605-185392627 TAGAGGGCTGCACTTTGTTCTGG + Intronic
967071314 3:185964769-185964791 TAGAGGGCTGCACTTTGTTCTGG - Intergenic
969042008 4:4306495-4306517 CTGGAGGCTGCACATTGTGCTGG + Intronic
969706118 4:8792994-8793016 CAGGAGAGTGCCCTTTGCCCAGG + Intergenic
971820054 4:31539967-31539989 CAAGAGGCTCCCCTGTGGTCTGG + Intergenic
977295559 4:95205035-95205057 CCGGAGGCTTTCCTTTGTCCTGG - Intronic
978418055 4:108499821-108499843 CTGTAGGCTGCATTTTGTTCTGG - Intergenic
978754852 4:112291007-112291029 CAGGAGGCTCCCCTGAGATCAGG - Intronic
981127614 4:141124352-141124374 GAGGAGGCTGCCACTAGTTCAGG + Intronic
982397147 4:154925237-154925259 GAGGTGGCTGCCATTTTTTCTGG - Intergenic
985347982 4:189027221-189027243 CTGGAGGCTTCCCATTATTCTGG + Intergenic
986299513 5:6466951-6466973 GAGGAGGCTGCTCACTGTTCTGG + Intronic
989604303 5:43229163-43229185 CATGAGGCTGACCTGAGTTCAGG + Intronic
990804895 5:59649099-59649121 TAGGCGGCTGCCCTGTTTTCAGG - Intronic
991300965 5:65128701-65128723 CAGGAGACGGCCCTGTGTCCTGG - Intergenic
992317162 5:75567869-75567891 TAGGAGGCTTCCCCTTGTTTAGG - Intronic
996388844 5:122938182-122938204 CACGAGGCTGCCCGTGCTTCTGG + Intronic
997529830 5:134575156-134575178 CAACAGGCAGCTCTTTGTTCAGG + Intronic
998481469 5:142466675-142466697 ACTCAGGCTGCCCTTTGTTCCGG + Intergenic
1002938871 6:1698725-1698747 CTGGAGGCCGCCCTCTGTCCAGG - Intronic
1005759673 6:28956696-28956718 CAGAAGGGAGCCCTTTGTGCAGG - Intergenic
1005933020 6:30497900-30497922 CTGGAGGCTGTGCTCTGTTCAGG - Intergenic
1005974564 6:30788213-30788235 CCCAAGGCTGCCCTTTGTACGGG - Intergenic
1007455904 6:41976894-41976916 CTTGAGGCTGCTGTTTGTTCAGG + Intronic
1007462676 6:42029908-42029930 CCAGAGGCTGCCCATTGTCCTGG - Intronic
1008581813 6:52914609-52914631 CAGCAGGTTGCCCTCTCTTCTGG + Intergenic
1009312098 6:62168045-62168067 CAGAAGGCTGCCCCTTTTTCTGG + Intronic
1011557825 6:88588022-88588044 CAGCAGGCAGCACTGTGTTCTGG - Intergenic
1016769385 6:147831574-147831596 AACGTGGCTGCCCTGTGTTCAGG + Intergenic
1018988651 6:168656919-168656941 CAGGAGGCTGCCCCCTGTGCTGG + Intronic
1022888122 7:34667444-34667466 TAGGAGGCTGGCCTTTGATGGGG - Intronic
1023233611 7:38060483-38060505 CAGGAGGCTGCTGGTTGTTTGGG - Intergenic
1023496374 7:40801621-40801643 CAGGAGGATGCCCCTTCTTCTGG + Intronic
1023635187 7:42202730-42202752 CAGGAGGCTGTCCTAAGTTAAGG - Intronic
1023980650 7:45068123-45068145 CAGGAGGTTTCCATGTGTTCTGG - Intronic
1024356283 7:48416655-48416677 CAGGAGGCTTCCCTTGGTCCCGG - Intronic
1025834490 7:65081827-65081849 CAGGAGGATGGCTTGTGTTCAGG + Intergenic
1026498234 7:70921681-70921703 GAGGAGGGTACCCTTTCTTCAGG + Intergenic
1027245711 7:76365914-76365936 CTGGAGGGTGCCCTTCGGTCAGG - Intergenic
1031342107 7:120615534-120615556 CTGGAGGCTGACTCTTGTTCTGG + Intronic
1032721691 7:134555301-134555323 CAGGAGTCAGTCCTTTTTTCTGG - Intronic
1034044942 7:147917813-147917835 CAGGAGTCTGGACTTTATTCTGG - Intronic
1034670217 7:152852139-152852161 CAGGAGGCTCCACCATGTTCAGG + Exonic
1035168436 7:157005168-157005190 CAGGAGGCTTCCCCTTGCGCGGG + Exonic
1037570374 8:20152847-20152869 GAGGAGTCTGGCCTTTGATCAGG + Intronic
1037794301 8:21978925-21978947 TAGGAGGCTGACCTCTGTTGAGG - Intronic
1037882136 8:22578646-22578668 CAGGAGGGTGGCCTTGGTTTGGG + Intronic
1039978335 8:42385663-42385685 CAGGAGCCTGGACTTTGTGCTGG - Intergenic
1042166436 8:65950452-65950474 CAGGAGGCTGCCCCTGGGTGTGG + Intergenic
1046097773 8:109580751-109580773 AAGGAGGCTGGCCTTTGTTCTGG - Intronic
1048167881 8:132079778-132079800 CAGGAGGCCTGCCTGTGTTCAGG + Exonic
1048503144 8:134996801-134996823 CATGGGCCTGCCCTTTGTCCCGG - Intergenic
1049268210 8:141680826-141680848 CAGGGGGCTGCACTGTGATCAGG + Intergenic
1052851907 9:33383717-33383739 GAGGAGGCTGGGCTTCGTTCTGG - Intergenic
1053221344 9:36315778-36315800 CCGAAGGCTGTCCTTTGTTTAGG + Intergenic
1055711460 9:79066601-79066623 CAAGAGTGTGCCATTTGTTCTGG + Intergenic
1056920434 9:90783362-90783384 CAGCAGGCTGCCCACTGTGCAGG + Intergenic
1057991041 9:99769969-99769991 CAGGACGATGCCCTTTGTGAAGG + Intergenic
1058311070 9:103503467-103503489 CAGTAGGCAGCGCTTTGTTGAGG - Intergenic
1059553694 9:115256468-115256490 CATGAGGCTGGCATTTGCTCAGG + Intronic
1061651834 9:132056814-132056836 CTGGAGCCAGCTCTTTGTTCTGG - Intronic
1062699738 9:137892655-137892677 CGGGAGGCTGCCCTGTGCTGGGG - Intronic
1186398268 X:9232499-9232521 CAGGAGGCTCACCTTAGCTCAGG + Intergenic
1190287314 X:48970232-48970254 CACGTGGCTGCCTTTTGCTCGGG - Exonic
1190711139 X:53071412-53071434 GAGGAGGCTGCACTTTGGTTTGG - Intronic
1194441292 X:93937652-93937674 CAGAATGCTTCCCTTTGCTCTGG - Intergenic
1196154868 X:112417627-112417649 CAGGAGTCTGCCCTTTGAGAGGG - Intergenic
1200044940 X:153396450-153396472 GGGCAGGCTGCCCTCTGTTCCGG - Intergenic