ID: 1184199253

View in Genome Browser
Species Human (GRCh38)
Location 22:42954507-42954529
Sequence CACTTGAGCCTTCTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184199248_1184199253 1 Left 1184199248 22:42954483-42954505 CCTCCTGGGTGTAAGCGATCCTC 0: 1
1: 38
2: 1673
3: 33580
4: 112690
Right 1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG 0: 1
1: 0
2: 2
3: 24
4: 204
1184199247_1184199253 7 Left 1184199247 22:42954477-42954499 CCTCAACCTCCTGGGTGTAAGCG 0: 1
1: 9
2: 391
3: 10312
4: 58353
Right 1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG 0: 1
1: 0
2: 2
3: 24
4: 204
1184199249_1184199253 -2 Left 1184199249 22:42954486-42954508 CCTGGGTGTAAGCGATCCTCCCA 0: 2
1: 29
2: 926
3: 9464
4: 44111
Right 1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG 0: 1
1: 0
2: 2
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184199253 Original CRISPR CACTTGAGCCTTCTGAAGCT TGG Intronic
900819728 1:4877305-4877327 CAATTAAGCCTTCTGCAGGTGGG + Intergenic
900905824 1:5556616-5556638 CACCTGAGCCTTTTGCAGGTGGG - Intergenic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
905034325 1:34907406-34907428 GTCCTGAGCCTTCTGAAGTTAGG - Exonic
905890920 1:41517890-41517912 CACATGGGCCTTTTGGAGCTAGG - Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907177488 1:52538531-52538553 CACTTCAGCCTCCTGAGACTGGG - Intronic
907817632 1:57936022-57936044 CACTTGATCATCCTGAACCTTGG + Intronic
909415198 1:75398529-75398551 CACTTGAGAATACTGAAACTAGG + Intronic
910865929 1:91788067-91788089 CACTGGAGGCTTCATAAGCTGGG + Intronic
912197571 1:107417091-107417113 CACTTGAGCATTTTGATGATGGG - Intronic
913216310 1:116623684-116623706 CACTTGTGCCATCTGGACCTTGG - Intronic
914239878 1:145846266-145846288 CACTTTATCCTTCTGAGACTGGG - Intronic
914440587 1:147702325-147702347 TACGTCAGCCTTCTAAAGCTTGG - Intergenic
916190141 1:162170419-162170441 CACCTGGGCCTTCTGAATCCAGG + Intronic
916904619 1:169268770-169268792 CACTGGAGCCTTCTTAAGGGTGG + Intronic
916935747 1:169626545-169626567 CACTCCAGCCTGCTGAAGATTGG + Intronic
916946321 1:169731843-169731865 CACTTGAGTCCACTGAAGCCAGG + Exonic
917335540 1:173921034-173921056 CTCTTTAGTCTTCTGCAGCTTGG + Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
920982974 1:210855645-210855667 CACATGAGCCTACTGAGACTGGG - Intronic
924474424 1:244370855-244370877 CACTTAACCCTTCTGAGACTTGG + Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG + Intergenic
1065319794 10:24498703-24498725 CACATCAGCCTTCCAAAGCTGGG - Intronic
1067850586 10:49751462-49751484 CACTGGACTTTTCTGAAGCTGGG - Intronic
1068831122 10:61496015-61496037 GATTTCAGCCTTCTGAAACTTGG + Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070250834 10:74771690-74771712 CACTTCAGCCTTGAGAGGCTGGG - Intergenic
1070823412 10:79376183-79376205 CACTTGACCTCTCTGAACCTCGG + Intergenic
1071464080 10:85923633-85923655 CACTTCATCCTTCTGAGTCTTGG - Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072179635 10:92969102-92969124 GACTTTAGACTTCTGAGGCTAGG + Intronic
1072593201 10:96846366-96846388 CACCTGAGCCTCCTGAGGCTGGG + Intronic
1072669732 10:97420449-97420471 TTCTTGGGCCTTCTGAAGTTCGG - Intronic
1074688125 10:115978369-115978391 CACATGACCCTTCAGAACCTGGG - Intergenic
1074790475 10:116881575-116881597 CACTTGAGGCTGCTGCGGCTAGG + Exonic
1075462749 10:122629577-122629599 CACATGCTCCCTCTGAAGCTTGG + Intronic
1080033552 11:27687981-27688003 CATTTAAGTCTGCTGAAGCTGGG + Intronic
1086236213 11:84634071-84634093 CACTTGAGGCATCTGCAGCTTGG + Intronic
1086662535 11:89437829-89437851 TACTTGAGCATTCTCAAACTTGG - Intronic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1093402347 12:18761488-18761510 CATTTAAGTCTGCTGAAGCTGGG - Intergenic
1094494165 12:30979062-30979084 CCCTTGAGCCCTCTGAATCGGGG + Intronic
1095467487 12:42503184-42503206 CACTTGTGCATTCTGAGCCTTGG + Intronic
1096013869 12:48248231-48248253 CACTTGATCTTTTTGAATCTTGG - Intergenic
1096799599 12:54101377-54101399 CACTTGAGCCTTTGGTAGCTTGG - Intergenic
1097309360 12:58101763-58101785 GACATGAGCCTTCTGGAGCAGGG + Intergenic
1100382715 12:94076578-94076600 CGCTTCAGCCATCTGAGGCTTGG + Intergenic
1101068760 12:101050809-101050831 CCCTTGTGGCTTCTGAGGCTGGG - Intronic
1101736587 12:107467880-107467902 ATCTTGAGCCCTCTGAAGCCAGG - Intronic
1102232200 12:111270597-111270619 CAAGTTAGCCTTCTGAAGCTTGG - Intronic
1103717692 12:122955174-122955196 CACTTGACCATTCTGAAGTGAGG - Intronic
1104794234 12:131505974-131505996 CATTTGTCCCTTCTGATGCTAGG - Intergenic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1109477524 13:62902032-62902054 CACTAGAGGTTTCTGAATCTTGG + Intergenic
1110507089 13:76299441-76299463 AACTTGAGCCTCCTGAAGTTTGG + Intergenic
1112611656 13:100961019-100961041 CACTTCAACCTTCTGAAAATTGG + Intergenic
1114061648 14:19023471-19023493 CACCTGAGCCTGGGGAAGCTGGG - Intergenic
1114100614 14:19376536-19376558 CACCTGAGCCTGGGGAAGCTGGG + Intergenic
1116840277 14:49813717-49813739 CACCTCAGCTTTCTGTAGCTGGG + Intronic
1118823938 14:69363446-69363468 TACTTGAACTTTCTGAAACTCGG + Intergenic
1124921198 15:34028449-34028471 CACCTCAGCCTTCTGAATATGGG - Intronic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1127370935 15:58339909-58339931 CACTTCAGCCTCCCGAAGTTCGG + Intronic
1129524385 15:76204590-76204612 CACTCTACCCTGCTGAAGCTGGG - Exonic
1133715829 16:8447740-8447762 GACTAGAGCATTCTGATGCTTGG + Intergenic
1137480680 16:48849520-48849542 CCCTAGAGACTTCTGATGCTAGG - Intergenic
1140389234 16:74570987-74571009 CACTTTAACCTTTTGAATCTGGG + Intronic
1143349154 17:6274752-6274774 CAGATGAGCCTTATGAGGCTTGG + Intergenic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1148121101 17:45211937-45211959 CTCTTGAGCCTTGAGTAGCTGGG - Intergenic
1150195542 17:63294358-63294380 CATTTCAGCCTCCTGTAGCTGGG - Intronic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1151935096 17:77256616-77256638 CCCTGGAGCCTTCTGAAGGGTGG + Intergenic
1152567200 17:81105640-81105662 CATTTGTGCCTTCCTAAGCTTGG + Intronic
1153516639 18:5909691-5909713 CATTTCAGGATTCTGAAGCTGGG + Intergenic
1155245133 18:23901072-23901094 CAGATGAGCATACTGAAGCTGGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156362868 18:36399714-36399736 CAAATGAGCCTTCTGCAGCAGGG - Intronic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1157134991 18:45045336-45045358 CACTTGCACCTGCTGAACCTGGG + Intronic
1158796811 18:60856263-60856285 CATTTGGGCTTTCTAAAGCTCGG + Intergenic
1159759534 18:72407842-72407864 CATTTGCGCCCTCTGAAGCAGGG - Intergenic
1160298610 18:77658912-77658934 CACTTGAGCCATCTGGAGGAGGG - Intergenic
1160298618 18:77658959-77658981 CACTTGAGCCATCTGGAGGAGGG - Intergenic
1161982203 19:7635919-7635941 CCCTCCAGCCTTCTTAAGCTCGG + Intronic
1162932839 19:13965900-13965922 TACCTGTGCCTTCTGATGCTGGG - Intronic
1165193954 19:34086703-34086725 CATTTGAGCCTTCAGATGGTTGG - Intergenic
1165536474 19:36451271-36451293 CACTTGACTTTTCTTAAGCTAGG - Intronic
1168011871 19:53539389-53539411 TTTTTGAGCCTTCTGAAGATAGG + Intronic
926418885 2:12678015-12678037 GTCTAGAGCCCTCTGAAGCTTGG + Intergenic
927749512 2:25654803-25654825 TACTTAATCCTTCTGAATCTCGG + Intronic
927880921 2:26689529-26689551 CACATGAGCCATGTGAAGCATGG + Intergenic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
937439941 2:121907055-121907077 CACTTAATCCTTCGGAATCTAGG - Intergenic
938478998 2:131643606-131643628 CACCTGAGCCTGGGGAAGCTGGG - Intergenic
944175842 2:196828655-196828677 CACTTGAGCCCTCTAAATCTGGG + Intergenic
947564762 2:231186573-231186595 AACTTGAGCCTTCAGTGGCTGGG - Intergenic
1169057384 20:2634857-2634879 CAAGTGAGCCTTCTGAAGCAAGG - Intronic
1170859055 20:20085981-20086003 CACGTGAGCCCTCAGAACCTTGG - Intronic
1171796831 20:29572968-29572990 CACTTGAGCCTTTTGTAGCTTGG + Intergenic
1171851415 20:30311195-30311217 CACTTGAGCCTTTGGTAGCTTGG - Intergenic
1172509911 20:35493451-35493473 CCGTTGAGCCTCCTGGAGCTGGG - Exonic
1172995101 20:39064653-39064675 CACATGACCTATCTGAAGCTGGG + Intergenic
1173904583 20:46616812-46616834 CACCTCAGCCTTCTTAGGCTGGG + Intronic
1174620774 20:51872943-51872965 CACTTTAGCTTTCTGAGCCTCGG - Intergenic
1174969406 20:55256922-55256944 CACTTCAGCCTTCTTAAGTATGG - Intergenic
1175129330 20:56777532-56777554 CACTTTAGCCTTCTAAAGATGGG - Intergenic
1176266357 20:64211516-64211538 AACTTGAGCCCTTTGAGGCTGGG + Intronic
1176873096 21:14099684-14099706 CACTGGAGCCTTCCCGAGCTGGG + Intergenic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1180480134 22:15746075-15746097 CACCTGAGCCTGGGGAAGCTGGG - Intergenic
1180817655 22:18802051-18802073 CACTTGTGCCATCTGGACCTTGG - Intergenic
1181203870 22:21236506-21236528 CACTTGTGCCATCTGGACCTTGG - Intergenic
1181993527 22:26856961-26856983 CACTTAACCTTTCTGAAGCTGGG - Intergenic
1183439187 22:37813590-37813612 CACCTGGGCCTCCTGCAGCTTGG - Exonic
1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG + Intronic
1184205939 22:43003102-43003124 CTCTTGCCTCTTCTGAAGCTTGG + Intronic
1203223051 22_KI270731v1_random:58908-58930 CACTTGTGCCATCTGGACCTTGG + Intergenic
1203267778 22_KI270734v1_random:27912-27934 CACTTGTGCCATCTGGACCTTGG - Intergenic
950771760 3:15317259-15317281 CTCTAGAGCTTTCTGAGGCTGGG - Intronic
952380082 3:32797646-32797668 CACTTGACATTTCTGAAGCTGGG + Intergenic
953090284 3:39717944-39717966 CACATGAGCCCTTTGAATCTGGG - Intergenic
953975912 3:47381460-47381482 CACTTCCTCCTTCTGACGCTCGG + Intronic
954240423 3:49289361-49289383 CACTTCATCCCTCTGAACCTTGG - Intronic
955079787 3:55648069-55648091 CAGCTGAGCTTCCTGAAGCTGGG + Intronic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956496285 3:69830219-69830241 CACAAGAGCCTTCTGCAGTTTGG + Intronic
958122703 3:89312741-89312763 CACTGGGGCCTTCTGGAGCATGG - Intronic
958123386 3:89323403-89323425 AACCTGAGCATTCTGAACCTGGG + Intronic
958786545 3:98602869-98602891 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
960778038 3:121283849-121283871 CAGTTTAGCCTTCTGAAGGTAGG + Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
964985784 3:162736302-162736324 GAACTGAGCCTTCTGAAGCAAGG + Intergenic
965366070 3:167801579-167801601 CAGTTTAGCCTTCTGCAGCCAGG + Intronic
967377769 3:188824884-188824906 TACTTGAGGATTCTAAAGCTTGG - Intronic
971750275 4:30638242-30638264 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
971938545 4:33186159-33186181 CACATGAGCCTTTTAAATCTGGG + Intergenic
972893973 4:43595950-43595972 AACTTTAGCCTTCTAAAGATAGG + Intergenic
973896751 4:55421412-55421434 CACCTCAGCCTTCTGAGTCTGGG + Intronic
975586569 4:75955882-75955904 GACTTGCGCCTTCTGAAGACTGG - Intronic
977290661 4:95161393-95161415 CCCTGGAGAGTTCTGAAGCTTGG - Intergenic
977599747 4:98923427-98923449 CATTTCAGCCTCCTGAGGCTAGG + Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
979602748 4:122604325-122604347 CTCTTCAGAATTCTGAAGCTTGG + Intergenic
980959246 4:139458460-139458482 CACTGGAGCCTCCTGAAGGGTGG - Intronic
981349591 4:143713909-143713931 TACATGACCCTTCTGAATCTCGG + Intergenic
982137210 4:152282868-152282890 CACTTGGGCCTTCTGTGGCCAGG - Intergenic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
984553138 4:181184319-181184341 CACCTCAGCCTTCTGAAGAGGGG - Intergenic
984820729 4:183879674-183879696 CACTTGAGCCCCCTAAATCTGGG - Intronic
986020151 5:3794297-3794319 CACTTGTGCCTTCTGTAGAGAGG + Intergenic
986276963 5:6284442-6284464 CACTTAACCTTTCTGAAGTTTGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
993222658 5:85120996-85121018 CACTTGAGCCTTCTTTTTCTTGG + Intergenic
994178131 5:96734344-96734366 CCCTTAATCCTTCTGCAGCTCGG - Intronic
994829866 5:104766675-104766697 CACATGAGCCTTTTAAATCTGGG + Intergenic
995171890 5:109124111-109124133 CACCTCAGCCTTTTGTAGCTGGG - Intronic
1001305628 5:170570477-170570499 CACTTGAGAAGGCTGAAGCTGGG + Intronic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1005059953 6:21766681-21766703 CACTTAAGTCTACTGCAGCTTGG + Intergenic
1006106655 6:31720997-31721019 TTCTTGAGCCTTCTGAAGAGGGG - Intronic
1006830481 6:36965005-36965027 CACTGGTGACTCCTGAAGCTGGG - Intergenic
1007826660 6:44605903-44605925 CACTTAGGCCTTCTGAGGATTGG + Intergenic
1008017975 6:46542284-46542306 ATCCTGAGCCATCTGAAGCTAGG - Intergenic
1008791223 6:55237348-55237370 CACTGGAGGCTTTGGAAGCTGGG + Intronic
1010154465 6:72776925-72776947 CACCTGAGCCTTTGGAAGATGGG + Intronic
1013345142 6:109252920-109252942 CACTTGAACCTTTTTTAGCTGGG - Intergenic
1013354285 6:109333581-109333603 AACCTCAGCCTCCTGAAGCTAGG + Intergenic
1013624777 6:111926320-111926342 CACTTGAGCCTTCTGCATAAGGG + Intergenic
1017445372 6:154502697-154502719 CATTTGACTCTTCTGAAGCCTGG - Intronic
1018658066 6:166059164-166059186 CATTTCAGACTGCTGAAGCTTGG - Intergenic
1019807879 7:3141931-3141953 CACCTCAGCCTCCTGAGGCTGGG - Intronic
1020190734 7:5995348-5995370 CAGTTGAAACATCTGAAGCTGGG + Intronic
1021083336 7:16389139-16389161 CAGTGGAGCCTTCTGGATCTTGG - Intronic
1022000890 7:26225009-26225031 CACTTATGCCTTATAAAGCTGGG + Intergenic
1022143227 7:27511755-27511777 TACTTAACACTTCTGAAGCTTGG - Intergenic
1022692995 7:32676331-32676353 CACTAGTGACTTCTGAGGCTAGG + Intergenic
1023007177 7:35884312-35884334 CACTGGAGCATTCTGAATTTTGG + Intronic
1023036829 7:36138567-36138589 CTCTTGACCATTCTGAACCTTGG + Intergenic
1023297972 7:38736413-38736435 CACTTCAGCTTTCTGGAGCTTGG - Intronic
1024765105 7:52648642-52648664 CACTTGAGTCTTCTTCAGCATGG - Intergenic
1024836496 7:53525882-53525904 CACTTGAGTCCTCTGCATCTTGG - Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026233103 7:68502591-68502613 CAGATGAGGTTTCTGAAGCTAGG - Intergenic
1028509738 7:91610670-91610692 CACTTGACCCTGCCCAAGCTGGG + Intergenic
1028712362 7:93923825-93923847 CACTTGAGGTTTCTGGAGGTGGG - Intronic
1028926016 7:96357870-96357892 CACCTCAGCCTCCGGAAGCTGGG + Intergenic
1029914275 7:104190741-104190763 AACTTGAGCCCTCTGGAACTAGG - Intronic
1030000531 7:105055047-105055069 CTCCTGAGCCTACTGAATCTAGG + Intronic
1030557977 7:111050308-111050330 CACTTCCCCCTTCTGAAACTTGG + Intronic
1030647714 7:112081992-112082014 CACATGAGTATTCTGAGGCTGGG - Intronic
1030919809 7:115368884-115368906 CAGTTGAGCCATCTGAAACTTGG - Intergenic
1030940746 7:115646114-115646136 CACCTCAGCCTCTTGAAGCTGGG - Intergenic
1032033168 7:128501382-128501404 CACTTGGGCCTTCTGTTCCTGGG + Intronic
1033737603 7:144238914-144238936 CACTTGAACCATCTGAAGCTTGG - Intergenic
1033739178 7:144256195-144256217 CACTTGAACCATCTGGAGATTGG - Intergenic
1033745453 7:144312043-144312065 CACTTGAACCATCTGAAGCATGG + Intergenic
1035118824 7:156548043-156548065 CACATGAGCCTGCCGAAGCCTGG - Intergenic
1039909527 8:41813556-41813578 AACTTTAGTCTTCTGAAACTTGG + Intronic
1041396115 8:57393423-57393445 CTCTTTAGCTTTTTGAAGCTTGG + Intergenic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042978910 8:74503539-74503561 TACTTGACCTTTCTGTAGCTCGG + Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1047440924 8:124877837-124877859 CACTTGAGCTTCCTGAATCTTGG + Intergenic
1048414004 8:134206126-134206148 CACTACAGCTTTCTGAATCTTGG - Intergenic
1048630889 8:136241095-136241117 TACTTGAGGCTTCTCTAGCTTGG + Intergenic
1051521387 9:17992556-17992578 CACTTGAGTCATCTGAGGCTAGG + Intergenic
1052785650 9:32825803-32825825 CACTTGATCCTGCTGAGGCACGG - Intergenic
1056275597 9:84991627-84991649 CAACTGAGCCTTCCAAAGCTGGG - Intronic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1061463468 9:130758897-130758919 CACTACAGCCTTCTGAATCCCGG - Intronic
1062041552 9:134406704-134406726 CACTTTCGCCTTCTGCAGCGTGG + Intronic
1062200477 9:135300245-135300267 CTCTTGCTCCTTCTGGAGCTGGG - Intergenic
1185824476 X:3236677-3236699 CACATGAGCCATCTAAAACTGGG - Intergenic
1188195678 X:27229820-27229842 CACTTGAGCCTGGTGAATCTTGG + Intergenic
1193203676 X:78722382-78722404 CACTGGGGCCTTCTGGAGCGGGG + Intergenic
1196428281 X:115594938-115594960 TACCTTAGCTTTCTGAAGCTAGG + Intronic
1197619079 X:128726828-128726850 AACATGAACCATCTGAAGCTTGG - Intergenic
1198025957 X:132707465-132707487 CAGTTTAGCTTTCTGTAGCTGGG - Intronic
1199335186 X:146611103-146611125 CACTTGAGCCCTTTAAATCTGGG + Intergenic
1200041648 X:153375270-153375292 GCCTGGAGCCTTCTGGAGCTGGG + Intergenic
1200138980 X:153888159-153888181 CATTTGACCCCTCTGAACCTTGG - Intronic
1202341407 Y:23872796-23872818 GATTTGGGGCTTCTGAAGCTGGG + Intergenic
1202529359 Y:25797290-25797312 GATTTGGGGCTTCTGAAGCTGGG - Intergenic