ID: 1184199519

View in Genome Browser
Species Human (GRCh38)
Location 22:42957166-42957188
Sequence TGCCCACTAGAACACCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184199516_1184199519 2 Left 1184199516 22:42957141-42957163 CCTCTTTAAGGAGACTGACAGAA 0: 1
1: 0
2: 1
3: 20
4: 223
Right 1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG No data
1184199513_1184199519 27 Left 1184199513 22:42957116-42957138 CCTGGCTCACCAAATGAAAGCAG No data
Right 1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG No data
1184199514_1184199519 18 Left 1184199514 22:42957125-42957147 CCAAATGAAAGCAGCACCTCTTT 0: 1
1: 1
2: 0
3: 16
4: 264
Right 1184199519 22:42957166-42957188 TGCCCACTAGAACACCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184199519 Original CRISPR TGCCCACTAGAACACCAGGA GGG Intronic
No off target data available for this crispr