ID: 1184199816

View in Genome Browser
Species Human (GRCh38)
Location 22:42960641-42960663
Sequence TTTTCTTGTGCTGGATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184199816_1184199822 15 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 75
1184199816_1184199826 27 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199826 22:42960691-42960713 CCGGGACAGGGAAGAGAAAGAGG 0: 1
1: 0
2: 18
3: 303
4: 1595
1184199816_1184199827 30 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199827 22:42960694-42960716 GGACAGGGAAGAGAAAGAGGAGG 0: 1
1: 1
2: 34
3: 324
4: 2512
1184199816_1184199821 14 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199821 22:42960678-42960700 ACACCCTTCGAAGCCGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1184199816_1184199820 9 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199820 22:42960673-42960695 AATCTACACCCTTCGAAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1184199816_1184199819 8 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199819 22:42960672-42960694 TAATCTACACCCTTCGAAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184199816 Original CRISPR TTTTCTTGTGCTGGATCCAA AGG (reversed) Intronic
905752206 1:40476037-40476059 TTTTCTTGGGCTGGACACAGTGG - Intergenic
905880081 1:41457582-41457604 TTTTCTGCTCCTGGAACCAATGG + Intergenic
906199184 1:43948208-43948230 TTGTTTTGTGCTGAGTCCAAGGG + Intronic
906312367 1:44762978-44763000 AACTCTTGTGCTGAATCCAAGGG + Intronic
906758457 1:48346400-48346422 TTGTCTTGTGCTGTTTTCAAGGG - Intronic
906993983 1:50770177-50770199 TTTTCTTGTTCTGGTTTCAAGGG - Intronic
909767343 1:79372649-79372671 TTTACTTTTCCTGGATCCATCGG - Intergenic
912094919 1:106127537-106127559 TGTTCAAGTGCTGGATCCACAGG + Intergenic
912599298 1:110911929-110911951 TTGTCTTGTGCTGGTTCTCAAGG - Intergenic
912985159 1:114420344-114420366 TGTTCTTCTGTTAGATCCAAAGG - Intronic
914406879 1:147383962-147383984 TTTTCTTGAGCAGAATCTAAGGG - Intergenic
914857641 1:151364231-151364253 CTTTCTTGTGCATGATACAAAGG + Intergenic
917246115 1:173003225-173003247 TTTTCTTGGGCTGGGTGCAGTGG + Intergenic
917384112 1:174449904-174449926 TTTTCTTGATCTGCATCCATTGG + Intronic
917494085 1:175524362-175524384 TTCTCTTGTCCTGGATTCCAGGG - Intronic
917682892 1:177385696-177385718 GTCTCATGTGCTGGATCCAGAGG + Intergenic
918045934 1:180941090-180941112 TTTTCTTGTTCTGGTCCAAAGGG - Exonic
919560052 1:199106388-199106410 TTGTCTTGTTCTGGTTCCCAAGG - Intergenic
919592538 1:199522396-199522418 TTTTTTTTTGCTGCATCTAAAGG - Intergenic
920914048 1:210244827-210244849 TTTTATGCTGCTGGATTCAAAGG - Exonic
921167719 1:212518891-212518913 TTTTCTTGTGTTGTTTCCAAGGG - Intergenic
923345643 1:233049534-233049556 TTGTCTTGTTCTGGTTTCAAGGG - Intronic
924919727 1:248615620-248615642 TTTTCTTGTGCTGGTTTTTAAGG - Intergenic
1064693816 10:17945529-17945551 TTGTCTTCTGCTGGTTTCAAAGG + Intergenic
1066017023 10:31257590-31257612 TTTTTTCCTGCTGGATCAAATGG + Intergenic
1068181780 10:53528933-53528955 TTTTTTTGGTCTGGATCCTATGG - Intergenic
1068385019 10:56315605-56315627 TTTTCTTGTGCTGGTTCTTTAGG + Intergenic
1069667764 10:70175059-70175081 TTTTCTTGGGCTTGATGCAGTGG + Intergenic
1071214961 10:83390540-83390562 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1072087517 10:92094990-92095012 TATTCTTGTGTAGTATCCAATGG + Intronic
1072225488 10:93364828-93364850 CTTTCCTGTGCTGGATTCTAGGG - Intronic
1073478864 10:103772849-103772871 TTTTCTTGAGCTAGATAGAAAGG - Intronic
1074389327 10:113043930-113043952 TCTTTTTTTGCTGGATACAAAGG - Intronic
1077256218 11:1584666-1584688 GGTTCTTGTGGGGGATCCAAGGG - Exonic
1077563213 11:3278916-3278938 TTTTCTTGTGTAGGAACCCAAGG - Intergenic
1077569106 11:3324732-3324754 TTTTCTTGTGTAGGAACCCAAGG - Intergenic
1078298441 11:10100382-10100404 CTCTCTGGTGATGGATCCAAAGG + Intronic
1079309009 11:19347984-19348006 TGTCCTTGTGCTGGAGCCAGAGG - Intergenic
1079645301 11:22857103-22857125 TGGGATTGTGCTGGATCCAAAGG - Intronic
1080215349 11:29833413-29833435 TTGTCTTGTGCTGGTTTCAAGGG - Intergenic
1085787778 11:79470144-79470166 TTTTCTTGTGCTCCAACCCAGGG - Intergenic
1086927925 11:92660730-92660752 TTTTCTTGTTCTGGATTTTATGG + Intronic
1087466875 11:98519056-98519078 TTTTCTTGTTCTGGTTCTCAAGG + Intergenic
1087954870 11:104273469-104273491 TTTGCTTGTGGTGGAACCCATGG + Intergenic
1088070646 11:105779794-105779816 TTATCTTGTGCTTCATTCAAAGG + Intronic
1089049890 11:115536924-115536946 CTTTCTTGTGCTGGAAACCAGGG + Intergenic
1089914795 11:122143135-122143157 TTTTTGTGTGCTGCATCAAAGGG + Intergenic
1090337565 11:125983121-125983143 TTTCCTTATTCTGGAGCCAAAGG + Intronic
1090741627 11:129667219-129667241 TTTTCTTTTTCTGGATACACTGG + Intergenic
1094791390 12:33919670-33919692 CTTTCTTCCGCTTGATCCAATGG + Intergenic
1095377300 12:41545699-41545721 TTTTCTTTTGCTGTATAGAAAGG + Intronic
1098218281 12:68242387-68242409 TTTTGTTCTGCTGCATCCAAAGG + Intergenic
1098535320 12:71587551-71587573 TTTTCTTGAGCGGGAGACAAAGG - Intergenic
1098650275 12:72957910-72957932 TTTTCTTATGTTGTATACAAAGG + Intergenic
1100950638 12:99845292-99845314 TTGTCTTGTGCTGGTTTCCAAGG + Intronic
1106691238 13:32119568-32119590 TATTTTTGTGCTGGATGCTAAGG - Intronic
1107771350 13:43789878-43789900 TTTTCATGTGCATAATCCAAGGG - Intergenic
1108408994 13:50129388-50129410 GTTTCTGATGCTGGTTCCAATGG - Intronic
1108887481 13:55205724-55205746 TTATCTTGTGCTGCTTTCAAGGG - Intergenic
1108958023 13:56185587-56185609 TTATCTTGTGCTGGTTTCAAAGG - Intergenic
1109581145 13:64337111-64337133 TTTTCTAGTGATGTATTCAAAGG - Intergenic
1110736150 13:78939282-78939304 TTGTCTGGTGCTGGATCACAAGG - Intergenic
1111077257 13:83253322-83253344 TTGTCTTGTGCTGGTTTCCAAGG - Intergenic
1111476192 13:88751118-88751140 TTTTCTTGTGCAAGAGTCAATGG - Intergenic
1113210234 13:107970016-107970038 ATCTCTTTGGCTGGATCCAAGGG + Intergenic
1113420913 13:110170723-110170745 TTTTCTTGTTCAGGTTCAAAGGG - Exonic
1114279115 14:21174413-21174435 TTGTCTTGTGCTGGTTTCCAAGG - Intergenic
1115422353 14:33210781-33210803 TTTTTTTGTGCAGGATCATAAGG - Intronic
1116557277 14:46326744-46326766 TTTGCTTGTGCAGGAATCAATGG - Intergenic
1116693132 14:48136015-48136037 TTTTTTTTTTCTGGATACAAAGG - Intergenic
1116899139 14:50345100-50345122 TTTTCTTGAGCTGAATTCCATGG - Intronic
1120605501 14:86570920-86570942 TTTTCCTGGGCAGAATCCAAGGG - Intergenic
1120708525 14:87769632-87769654 TGTTCTTGTGTTGGATCCACTGG - Intergenic
1121040242 14:90740413-90740435 CTTTCTTGTGCTGAAGCCAGTGG - Intronic
1121157311 14:91698459-91698481 TTGTCTTGTTCTGGTTCCCAAGG + Intronic
1122474957 14:102001192-102001214 TTTTCATGAGCTGTTTCCAATGG - Exonic
1123131547 14:105989861-105989883 TGCTCTTGTGCTGGATCAAGTGG + Intergenic
1123820330 15:24023142-24023164 TTTTGTCCTGCTGCATCCAAAGG + Intergenic
1124343394 15:28904345-28904367 CTTTCTGGAGCTGGATCCCAGGG + Intronic
1124419581 15:29508825-29508847 TTATCTTGTGCTGGTTTCAAAGG - Intronic
1124450233 15:29781895-29781917 TTGTCTTGTGCTGGTTCTCAAGG - Intronic
1125273392 15:37965298-37965320 TTTTCTTGTGCTAGTTTCATAGG - Intronic
1127293158 15:57588162-57588184 CTTACTAGTGCTGGAACCAAGGG + Intergenic
1128223549 15:65985423-65985445 ATTCCTTGTGCTGGATCCTGTGG - Intronic
1128939137 15:71772919-71772941 GTATCTTGGGCTGGATGCAATGG + Intronic
1129795129 15:78370284-78370306 TTTTTTTCTGTAGGATCCAAGGG - Intergenic
1129971135 15:79778999-79779021 TTTTCTTGTGCTGGTTACATAGG - Intergenic
1130155845 15:81349310-81349332 TTTTCTTGAGTTGCATCCATAGG + Intronic
1137461104 16:48664403-48664425 TTGTCTTGTGCTGGTTTCAAAGG + Intergenic
1139377726 16:66510817-66510839 TTGTTTTCTGCTTGATCCAAGGG + Exonic
1143117680 17:4589852-4589874 TCTTCTTTTGCTGAACCCAATGG + Intronic
1148900814 17:50875460-50875482 TTTACTTGAGCTGAATCAAATGG - Intergenic
1149077489 17:52613799-52613821 TTTTCAAGTGTTGGATACAAAGG + Intergenic
1149777216 17:59367377-59367399 GTTTTTTGGGCTAGATCCAAAGG + Intronic
1150037952 17:61824973-61824995 TTTTCTTGTGCTGGTTTTCAGGG - Intronic
1151688202 17:75662281-75662303 TTTCCTTGTTCTGGATCCTGTGG - Intronic
1151774271 17:76188231-76188253 TTCTCTTGTACTGCATCCCACGG + Intronic
1153097857 18:1429298-1429320 TTTTCTGGTGCTAGAGCCAGTGG + Intergenic
1153497810 18:5717892-5717914 CTTCCTGGTGCTGGATCCAAAGG - Intergenic
1154100439 18:11468153-11468175 TTTTGTTGTGGTGGATTCATGGG - Intergenic
1155919973 18:31593855-31593877 TCCTCTTCTGCTGGATGCAAAGG - Intronic
1156171912 18:34494897-34494919 TTTTCTTTTGCTTATTCCAAAGG + Intronic
1156681949 18:39601010-39601032 TTTGCTTGTGTTGTTTCCAAGGG - Intergenic
1156759593 18:40571809-40571831 TACTATTGAGCTGGATCCAAAGG - Intergenic
1157769555 18:50333800-50333822 TTTTGTCCTGCTGCATCCAAAGG + Intergenic
1158057213 18:53295923-53295945 TTTTATTTTGCTGTATCCCAAGG + Intronic
1158545335 18:58391474-58391496 TTTTCTTGTCTAGGTTCCAATGG + Exonic
1158584580 18:58720096-58720118 TATTCTTTTGCTGAATCCACTGG + Intronic
1158790807 18:60778464-60778486 TTTTCTTGTTCTGGTTCTCAAGG - Intergenic
1160602384 18:80023518-80023540 TTTTCTTATGCTGGTTGCATGGG - Intronic
1162347920 19:10131472-10131494 TTTTCTTTTTCTGGATTCCAAGG - Intergenic
1163323711 19:16589532-16589554 TTTTTTTGTCCTGGATTAAAAGG + Intronic
1164928575 19:32152664-32152686 TTTGTTTGTGCTGGATGCATTGG - Intergenic
1168645743 19:58058020-58058042 TTTCCTTTTACTGGATCAAAAGG - Intergenic
927307564 2:21590994-21591016 TTTTCCTCTGCTAGATCAAAAGG - Intergenic
927726289 2:25425981-25426003 CTTGCTTGAGCTGGGTCCAAGGG - Intronic
930137024 2:47912635-47912657 CTGTCTTGTGCTGGTTTCAAAGG + Intergenic
930211150 2:48638648-48638670 TTGTCTTGTGCTGTTTTCAAGGG - Intronic
931222095 2:60297306-60297328 TTTTCTTGAGCTGGTGCCCATGG - Intergenic
931514179 2:63032855-63032877 TTTTCTTTTGCTTCAACCAAAGG + Intronic
934129095 2:88929787-88929809 CTTTCTTGTGCAGGAGCCGAGGG + Intergenic
936343089 2:111654885-111654907 TTTTCTTTTTCAGGATTCAAGGG - Intergenic
936495419 2:113016143-113016165 TTTGCTTGTGCTGGAATCAAAGG + Intergenic
937581024 2:123488064-123488086 TTCTCTTCTGCAAGATCCAATGG + Intergenic
938376625 2:130811804-130811826 TTGTCTTGTGCTGGTTTCAAGGG + Intergenic
939059812 2:137408036-137408058 TTAACTTGTTCTGAATCCAAAGG + Intronic
939158099 2:138549515-138549537 TGTTCTTGTACTGTATCCAATGG - Intronic
940387567 2:153091113-153091135 TTTTCTTGAGCAGAATCCAGAGG - Intergenic
940410585 2:153359508-153359530 ATTGTTTGTGCTGCATCCAATGG - Intergenic
941940025 2:171025533-171025555 ATTTCCTGTGCAGGATACAAGGG + Intronic
942073468 2:172336030-172336052 TTTTCTTGTCAAGGATCCTATGG - Intergenic
943200751 2:184820491-184820513 TTTTCTTGTGCTGGTTTTCAAGG - Intronic
944774490 2:202948913-202948935 TTTTCTTGTGCTGGTTTTCAAGG + Intronic
946730498 2:222704932-222704954 CTTTCTTGTGTGAGATCCAAGGG - Intronic
1168730180 20:70692-70714 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1169003542 20:2187157-2187179 TTTTCTTGTTCTTGATCTTAAGG + Intergenic
1172307830 20:33894146-33894168 TGTTCTTTTGGTGGATTCAAAGG + Intergenic
1177506220 21:22021163-22021185 TTTTCTTTTTCTGGATCTGAAGG - Intergenic
1183178748 22:36244391-36244413 TTTTCTTGAGCAGAATCCAGGGG - Intergenic
1183666834 22:39250860-39250882 TTTGCTTGTGGTGGGTCCACAGG + Intergenic
1183808594 22:40234853-40234875 TTTTCATTTGCTGGATCTGAGGG - Intronic
1184199816 22:42960641-42960663 TTTTCTTGTGCTGGATCCAAAGG - Intronic
1185122441 22:48980291-48980313 TTTTCTTGTGCTTTTCCCAATGG + Intergenic
949494426 3:4618666-4618688 TTTCCATGTGCCGGATCCATCGG + Intronic
949811099 3:8007078-8007100 ATTTCCTGTGCTGGGTACAAAGG - Intergenic
950154495 3:10711334-10711356 TTTTCATGTGCTGGAGCTAAAGG + Intergenic
951021853 3:17789914-17789936 TTTTCTTGAGCAGAATCCAAAGG - Intronic
951212399 3:19990070-19990092 TTTTATTGTGCTGAATCCAAAGG - Intronic
952172489 3:30823402-30823424 TTTTCTTGTTTGGGACCCAAAGG + Intronic
952197757 3:31093789-31093811 TTCTCTTGTGTGGGATTCAAAGG + Intergenic
952201245 3:31130255-31130277 TTTTCTTGGGCTGGGTGCAGTGG - Intergenic
952762497 3:36927071-36927093 TTTTGTTCTGCTGGCTCCAAAGG - Intronic
952957885 3:38569890-38569912 TTTTCTACTACTGAATCCAAAGG - Intronic
952984935 3:38770703-38770725 TTTTCTTGAGCAGAATCCAGGGG - Intronic
953037997 3:39229489-39229511 TTTTCTTTTGCTGTCTCCTATGG + Intergenic
953065951 3:39471414-39471436 TTTTCTTTTGCTGGGTGCAGTGG - Intronic
953374518 3:42417462-42417484 CTTTAGTTTGCTGGATCCAAAGG - Intergenic
953773862 3:45799305-45799327 TTTTCTTGTGCTGGTTCCCTGGG + Intergenic
955435222 3:58892897-58892919 TTGTCTTGTGCTGGTTTCCAAGG + Intronic
956210261 3:66795248-66795270 GTTTCTGGTGCAGGATCAAATGG - Intergenic
956386119 3:68721464-68721486 TTGTCTTGTGCTGGTTCTCAAGG + Intergenic
956658791 3:71580441-71580463 TTTTCTTTTCCTGGACCCAAAGG + Intronic
956980980 3:74637012-74637034 TTTTGTTGTACTAGCTCCAATGG + Intergenic
957587560 3:82151912-82151934 TTTTATTGTGTTGAATTCAATGG + Intergenic
958447844 3:94237086-94237108 TTGTCTTGTGCTGGCTCAAAGGG + Intergenic
959080260 3:101793325-101793347 TTTTCTTGTGCTGGTTTTCACGG + Intronic
959285151 3:104399218-104399240 TTATCTTGTGCTGGTTTCCAAGG - Intergenic
960214686 3:115016957-115016979 TTGTCTTGTGCTGGTTTTAAAGG - Intronic
961020343 3:123500662-123500684 TTTCATTGTGCTGTACCCAATGG - Exonic
962111510 3:132454759-132454781 TTTTCCTGTCCTGAATTCAATGG + Intronic
962687168 3:137858835-137858857 TTTTCTTTTGCTCCACCCAAGGG + Intergenic
964367727 3:155967589-155967611 TTTTCTTGAGCTGTATCCTATGG - Intergenic
965649806 3:170922040-170922062 TTGTCTTGTGCTGGTTTTAAAGG - Intergenic
965748157 3:171947016-171947038 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
966227641 3:177615192-177615214 TTTCCCTGGGCTGGAGCCAAGGG - Intergenic
966810552 3:183840015-183840037 TTTTCTTAGGCTGGATGCAGTGG - Intronic
966842074 3:184098076-184098098 TGTCCATCTGCTGGATCCAAGGG + Intronic
967563770 3:190949479-190949501 TTTTGTTGTGCTGAACACAATGG + Intergenic
967580544 3:191147897-191147919 TTGTCTTGTGCTGGTTTCTAGGG + Intergenic
968237789 3:197047057-197047079 TGTTCTGGTGCAGGATCCAGCGG - Intronic
973210644 4:47611660-47611682 TTGTCTTGTGCTGGTTTCCAAGG + Intronic
973248757 4:48039663-48039685 ATTTCATGTGCTAAATCCAAAGG - Exonic
974323007 4:60376279-60376301 TTTTCTTCTCATGGGTCCAAAGG - Intergenic
974716840 4:65678848-65678870 ATTTTGTGTGCTGGACCCAAGGG + Intergenic
974725217 4:65789971-65789993 TTTTCTTAGGCTGGATTCCAGGG - Intergenic
975285590 4:72615316-72615338 GTTTCTTGTGCTTGATCAATGGG - Intergenic
976153977 4:82122867-82122889 TTTTCTTGTTCTGGAAGCACTGG + Intergenic
976209976 4:82658162-82658184 TTGTCTTGTGCTGGTTTCAAAGG + Intronic
976262284 4:83157030-83157052 TTTTGTAGTGCTGGTTACAATGG + Intergenic
976565860 4:86550270-86550292 TTTTGGTGTGCTAGATCCACAGG + Intronic
977627548 4:99203600-99203622 TTTTTTTCTGCTGGATCCCTAGG + Exonic
978025256 4:103865516-103865538 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
978640900 4:110870290-110870312 TTTTGTTGTGTTGGATCAAAAGG + Intergenic
978870629 4:113572754-113572776 TTTGCTTTTGCTGGGTCGAATGG - Intronic
980333279 4:131437123-131437145 TTGTCTTGTGCTGGTTTCCAGGG + Intergenic
981171890 4:141635339-141635361 TTTTCTTGTGATGGTGTCAATGG - Intergenic
982576090 4:157111840-157111862 CTTTCTTTTGCTGAATCCCATGG + Intronic
983287750 4:165760774-165760796 TTTAACTGTGCTGGATCCAGTGG + Intergenic
983371519 4:166865355-166865377 TTGTCTTGTGCCGGTTTCAAAGG - Intronic
983384039 4:167035449-167035471 TTTTCTTGAGCTGGCTCGTAAGG - Intronic
985295085 4:188428463-188428485 TTTTCTACTGCTGGACACAAAGG + Intergenic
985338898 4:188926607-188926629 TTATTTTATGCTAGATCCAAGGG - Intergenic
986092532 5:4524409-4524431 TTTTATTGTGTTGGACCCATTGG - Intergenic
986417818 5:7546155-7546177 TTTTCTTGTGCGGATTCCTATGG + Intronic
986882167 5:12187523-12187545 GTTTCTTTTGCAGGCTCCAAGGG - Intergenic
988305994 5:29494776-29494798 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
989432173 5:41368603-41368625 TTGTCTTGTGCTGGATTTCAAGG + Intronic
990230553 5:53708721-53708743 TTGTCTTGTGCTGGATTTCAAGG + Intergenic
990705095 5:58519318-58519340 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
990859764 5:60314013-60314035 TTGTCTTGTGCTGGCTCTCAAGG - Intronic
991927171 5:71717340-71717362 TTTTCTTGTGCAGAATCAAAAGG + Intergenic
993403749 5:87485695-87485717 TTGTCTTGTGCTGGTTTCAAAGG + Intergenic
994550912 5:101233869-101233891 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
994903898 5:105811247-105811269 TTTTCTTTTTCTAGATCCTAAGG + Intergenic
995757504 5:115524727-115524749 GTTTCTTAAGCTGCATCCAAGGG - Exonic
996181791 5:120428467-120428489 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
997240521 5:132303434-132303456 TTTTCTTGTGCTGGGAGGAAGGG - Intronic
998755630 5:145375817-145375839 TTTTCCCCTGCTGGAGCCAAGGG - Intergenic
1000069335 5:157725052-157725074 TTGTCTTGTACTGGTTTCAAAGG - Intergenic
1000670206 5:164052304-164052326 TCTTCTTTTGCTAGTTCCAAAGG + Intergenic
1001008046 5:168072378-168072400 TTCTCTTGGGTTGGATCAAAAGG + Intronic
1003083472 6:3041674-3041696 TTTTGTCCTGCTGTATCCAAAGG - Intergenic
1003352405 6:5330435-5330457 GTTTCTTATGCTGGCTCCACGGG + Intronic
1005713282 6:28523091-28523113 TTTTCTTGGGCTGGGTCCAGTGG + Intronic
1007103934 6:39270446-39270468 TTCTCTTGTGTTAGAACCAAGGG - Intergenic
1007346444 6:41233140-41233162 TTTTATTTTGCTGGATGAAAGGG - Intronic
1007349435 6:41258203-41258225 TTTTCTTGAGCAGAATCCAGGGG + Intergenic
1007460842 6:42017545-42017567 GGATCTTGTGCTGGATGCAATGG - Intronic
1008093304 6:47314002-47314024 TCTTCTTATTCTGGATCAAAAGG - Intergenic
1008733413 6:54511669-54511691 TCTTTTTGTAGTGGATCCAATGG + Intergenic
1009547246 6:65035274-65035296 TTGTCTTGTTCTGGTTCCCAAGG - Intronic
1010674961 6:78732230-78732252 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1010975859 6:82312978-82313000 TTTTCTTGAGCCGAATCCAAGGG + Intergenic
1011135007 6:84090550-84090572 TTTTCTTGTTCTGTAGCCAATGG - Exonic
1011501513 6:87995657-87995679 TGTTCTTTTGCTGGATGCAAAGG - Intergenic
1012076331 6:94691272-94691294 GTTTCCTGGGCTGGGTCCAAAGG - Intergenic
1014485127 6:121989742-121989764 TTGTCTTGTTCTGGTTCCTAAGG + Intergenic
1014613916 6:123579207-123579229 TTTTCTTGTGCTGGTTTTCAAGG + Intronic
1016693837 6:146969437-146969459 TTCTCTAGTGCTGGCTGCAATGG - Intergenic
1018218663 6:161556691-161556713 TATTCTTGTATTGGTTCCAAGGG + Intronic
1020619490 7:10500852-10500874 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1020996444 7:15271733-15271755 TTTTCTTGTTCTGGTTCTTAGGG + Intronic
1021004720 7:15380083-15380105 TTGTCTTGTGCTGGTTTCAAGGG - Intronic
1021247688 7:18283934-18283956 TTTTCTTTTGCTGGGGCCAGAGG - Intronic
1021533174 7:21672804-21672826 TTTTCCTGTCCTGGCTCCCATGG - Intronic
1021610474 7:22452930-22452952 TCTTCTTGGGCAGGATTCAAAGG - Intronic
1022878112 7:34556606-34556628 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1025281835 7:57631823-57631845 TTTTCTTCTGTTGGTTCCATCGG + Intergenic
1025302894 7:57833694-57833716 TTTTCTTCTGTTGGTTCCATCGG - Intergenic
1030121741 7:106116715-106116737 TTTTGTTCTGCTGCATTCAAAGG + Intergenic
1030732644 7:113008225-113008247 TTGTCTTGTGCTGGTTCTCAGGG + Intergenic
1031254647 7:119432207-119432229 TTTTCTTGTGCAGGTTTCCAAGG - Intergenic
1032987806 7:137358495-137358517 TTGTCTTGTGCCGGTTTCAAAGG + Intergenic
1034122421 7:148639765-148639787 TTTTCTTATTTTGGATGCAATGG - Intergenic
1035554011 8:551256-551278 TTTTCTTCTGCTTGATCTATTGG + Intergenic
1036179374 8:6569874-6569896 TTCTCTTGAGCTGGAGCCACTGG + Intronic
1037862366 8:22414758-22414780 TTTTCTTTTCCTGGGTCCACAGG + Exonic
1042341733 8:67686569-67686591 TTTTCTTTTGCAGTATACAATGG - Intronic
1042742761 8:72069184-72069206 TTTTCTAGTGCTGCATGAAATGG - Exonic
1043239094 8:77908753-77908775 TTTTATTTTGCTGAATCCAAAGG + Intergenic
1043329827 8:79101824-79101846 TTGTCTTGTGCTGGTTTCCAAGG + Intergenic
1044149752 8:88760791-88760813 TTTTCCTATGCTGCATCTAAAGG + Intergenic
1044214207 8:89588446-89588468 TTTTCTTGTGCTGGTTTTCAAGG - Intergenic
1044281661 8:90363725-90363747 TGTGCTGCTGCTGGATCCAATGG + Intergenic
1044314685 8:90736134-90736156 TTTTCTTGTGCTGGTTTTCAAGG - Intronic
1044697507 8:94937646-94937668 TTTTCCTCTACTGGATGCAATGG + Intronic
1045875090 8:106972196-106972218 TTTACTTTTACTGGAGCCAAAGG - Intergenic
1046677334 8:117124636-117124658 TTTTTTTTTTCTGGATACAAGGG - Intronic
1048732407 8:137457931-137457953 TTTTCTTGTGATGTTTCCAAAGG + Intergenic
1050245828 9:3688921-3688943 CTTTCTTGCCCTGGATTCAATGG - Intergenic
1051030329 9:12667084-12667106 GTTTCTTGTGTGAGATCCAAGGG - Intergenic
1051191828 9:14521019-14521041 TTTTCTTGTCCTGAATCAATGGG - Intergenic
1051311960 9:15785019-15785041 TTTTCTTGTTTTGTACCCAATGG + Intronic
1052271527 9:26632802-26632824 CTTTCTGGTTCTGGTTCCAAGGG + Intergenic
1053235093 9:36446401-36446423 TTTTCTTGTGCAGGAAACACAGG - Intronic
1054903505 9:70393626-70393648 TTTACTTTTGCTAGATGCAATGG - Intronic
1057002449 9:91523949-91523971 ATTTCTTGTGGCGGCTCCAAGGG - Intergenic
1057285786 9:93753005-93753027 GTTTCTTATTCTGGATCAAAAGG - Intergenic
1060142525 9:121222796-121222818 TTTTCTAGAGCAGGAACCAAAGG + Intronic
1060322701 9:122579458-122579480 TTTCCTTGTACTGGAGCAAAAGG + Intergenic
1185431140 X:12840-12862 TTGTCTTGAGCTGGAACCACAGG - Intergenic
1185440407 X:225237-225259 TTGTCTTGAGCTGGAACCACAGG - Intergenic
1186816565 X:13243539-13243561 TTTGCTTCTGCAGGGTCCAAAGG + Intergenic
1187805311 X:23113171-23113193 TTTTCTTGTGCCGGCATCAAAGG + Intergenic
1188742394 X:33801274-33801296 TTTTCTTGAGCAGAATCCAGGGG - Intergenic
1190430626 X:50374892-50374914 TGGTCTTGTGCTTGGTCCAAGGG - Intronic
1191638644 X:63406210-63406232 TTTTCTTGGGCTGGGTGCAGTGG + Intergenic
1191670989 X:63748691-63748713 TTTTCATGGGCTAGATCCCAGGG - Intronic
1191747443 X:64504920-64504942 TTGTCTTGTTCTGGTTCCAAAGG - Intergenic
1193028388 X:76871047-76871069 TTTTCTTGTGCTGGTTTTAAAGG - Intergenic
1193160333 X:78221359-78221381 TTTTCTTTTGCTGGTTTCCAAGG + Intergenic
1193351191 X:80466633-80466655 TTGTCTTGTGCTGGTTTTAAAGG - Intergenic
1193362544 X:80592945-80592967 TTGTCTTGTGCTGGATTTCAAGG - Intergenic
1193578004 X:83227527-83227549 TTTTCTTGTTCTGGTTCTCACGG + Intergenic
1193774429 X:85624350-85624372 TTGTCTTGTTCTGGTTCCCAAGG - Intergenic
1194137546 X:90164936-90164958 TTGTCTTGTGCTGGATTGCAAGG - Intergenic
1194918150 X:99729874-99729896 TTTTCTTGTGCAGGTTTGAAAGG - Intergenic
1195544096 X:106095849-106095871 TTTTCTTGTGCTGGTTTTCAAGG + Intergenic
1196065172 X:111456331-111456353 ATTCCTTGTGTTAGATCCAAAGG - Intergenic
1198536448 X:137591275-137591297 TTTTTTTTTTCTGGAGCCAAGGG + Intergenic
1198702592 X:139413950-139413972 GCTTCTTATTCTGGATCCAAGGG + Intergenic
1199408750 X:147494426-147494448 TTTTCTTTTGCTGAATCCACTGG - Intergenic
1200483279 Y:3734872-3734894 TTGTCTTGTGCTGGATTGCAAGG - Intergenic
1200939895 Y:8770309-8770331 TTTTCTTGTGGTGGCTGGAATGG + Intergenic
1202274492 Y:23101525-23101547 ATTTCTTGTGATGGATCCTGAGG - Intergenic
1202291535 Y:23319161-23319183 ATTTCTTGTGATGGATCCTGAGG + Intergenic
1202427485 Y:24735260-24735282 ATTTCTTGTGATGGATCCTGAGG - Intergenic
1202443306 Y:24934834-24934856 ATTTCTTGTGATGGATCCTGAGG + Intergenic