ID: 1184199818

View in Genome Browser
Species Human (GRCh38)
Location 22:42960650-42960672
Sequence AGTTACGCCTTTTCTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184199818_1184199828 25 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199828 22:42960698-42960720 AGGGAAGAGAAAGAGGAGGCAGG No data
1184199818_1184199820 0 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199820 22:42960673-42960695 AATCTACACCCTTCGAAGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1184199818_1184199819 -1 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199819 22:42960672-42960694 TAATCTACACCCTTCGAAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
1184199818_1184199826 18 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199826 22:42960691-42960713 CCGGGACAGGGAAGAGAAAGAGG 0: 1
1: 0
2: 18
3: 303
4: 1595
1184199818_1184199822 6 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 75
1184199818_1184199827 21 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199827 22:42960694-42960716 GGACAGGGAAGAGAAAGAGGAGG 0: 1
1: 1
2: 34
3: 324
4: 2512
1184199818_1184199829 29 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199829 22:42960702-42960724 AAGAGAAAGAGGAGGCAGGCAGG 0: 1
1: 1
2: 20
3: 220
4: 1843
1184199818_1184199821 5 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199821 22:42960678-42960700 ACACCCTTCGAAGCCGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184199818 Original CRISPR AGTTACGCCTTTTCTTGTGC TGG (reversed) Intronic
900528470 1:3140866-3140888 AGCTCCGGCTTTTCTTCTGCGGG - Intronic
904816306 1:33202968-33202990 AGTTACTCCTTTCCTTTTGTGGG + Intergenic
904918591 1:33988048-33988070 ATTTAAGACTTTTCTTGAGCTGG + Intronic
906559967 1:46749096-46749118 AGTTACGCATTTTTTGCTGCTGG - Intergenic
909525400 1:76616487-76616509 ATTTAGGAATTTTCTTGTGCTGG + Intronic
911750535 1:101491894-101491916 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
913992228 1:143625315-143625337 TGTTAGTCTTTTTCTTGTGCAGG + Intergenic
916889535 1:169102993-169103015 AGTTGCGCCCTCTCTTTTGCAGG + Intergenic
919164926 1:193880419-193880441 AGTTATACCTTATCTTGTGTTGG - Intergenic
919389366 1:196963078-196963100 ATTTGTGCCTTTTCTGGTGCTGG - Intergenic
919407782 1:197206271-197206293 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
921123836 1:212159515-212159537 AGTTGCTCCTTTTCTCCTGCAGG - Intergenic
922892844 1:229074804-229074826 AGTTACGGCTTTTCCTTTGGGGG + Intergenic
1063886999 10:10589691-10589713 ACTCACGTCTTTTCTTGTGGGGG - Intergenic
1067579178 10:47429888-47429910 AGGGCAGCCTTTTCTTGTGCCGG + Intergenic
1069113180 10:64471581-64471603 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1071134262 10:82435466-82435488 AGTTATTCCTTGTCTTCTGCTGG + Intronic
1071345445 10:84687716-84687738 AGTTTCGCTCTTTGTTGTGCAGG - Intergenic
1077775238 11:5263571-5263593 AGTTATTCCCTTTCTTTTGCTGG - Intronic
1079255701 11:18827421-18827443 TGTTATGTCTTTTCTTCTGCTGG + Intergenic
1080060035 11:27947398-27947420 AGTTCTTCCTTTTCTTCTGCAGG - Intergenic
1080619455 11:33974943-33974965 AGATACTCCTTTTATTTTGCTGG + Intergenic
1084367674 11:68713314-68713336 AGTTGCACCCTTTGTTGTGCTGG + Exonic
1085876267 11:80409515-80409537 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1086743156 11:90392383-90392405 TGTTACTGCTTTTCTTCTGCTGG - Intergenic
1087428073 11:98015497-98015519 AGTTACTTCTTGTCTTCTGCTGG - Intergenic
1089041856 11:115459292-115459314 AGTTAGGCCTTTTGTTGGGTGGG - Intronic
1091067340 11:132528161-132528183 GGTTAGGGCTTTTCTTGTCCTGG + Intronic
1096957132 12:55537791-55537813 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1097435444 12:59548494-59548516 TTTTAAGCCTTTTTTTGTGCTGG + Intergenic
1097751527 12:63359746-63359768 AGTTACACTATTTCTGGTGCAGG + Intergenic
1099295578 12:80823997-80824019 AGTTATTTCTTTTCTTCTGCTGG - Intronic
1102478171 12:113202228-113202250 AGGTCCCCCTTTTCTTGTGGAGG + Intronic
1103370948 12:120419016-120419038 AGTTACTCCTTTTTTTGAGACGG + Intergenic
1109792659 13:67269889-67269911 AGTTTCGCCCTTTGTTGTCCAGG - Intergenic
1110504961 13:76274801-76274823 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1111212901 13:85103377-85103399 AGTTACTCTTTTTCTTGTTTTGG - Intergenic
1112978752 13:105354980-105355002 AGTTACACCTTTTCTTGCACAGG + Intergenic
1116989405 14:51259124-51259146 GATTATGCCTTTTCCTGTGCAGG + Intergenic
1118077094 14:62311230-62311252 AGTTAGGCCTTTTCTAGTAGAGG - Intergenic
1120148515 14:81006014-81006036 AGTTATGCCTTTTACTGTGTGGG - Intronic
1121475782 14:94200848-94200870 TGTTACTTCTTTTCTTCTGCTGG + Intronic
1127090480 15:55461760-55461782 TGTTATTTCTTTTCTTGTGCTGG - Intronic
1128290721 15:66476522-66476544 AGTCTCGCCTTCTCTTGTGCTGG - Intronic
1139319730 16:66104696-66104718 AGTTACATCTTTTATTGAGCAGG - Intergenic
1144096097 17:11901998-11902020 ACTTCTTCCTTTTCTTGTGCTGG - Intronic
1147525384 17:41217182-41217204 TTTTCAGCCTTTTCTTGTGCTGG - Intronic
1154298184 18:13168958-13168980 TGTTATTCCTTTTCTTGTGCTGG - Intergenic
1155306551 18:24484249-24484271 ATTTAGGCCTTTTCATGTGCCGG + Intergenic
1155882470 18:31166760-31166782 AGCTCCGCCTTTTTTTGTGTTGG + Intergenic
1156095739 18:33529873-33529895 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
1158112215 18:53952804-53952826 TGTTACTTCTTTTCTTCTGCTGG - Intergenic
1165122983 19:33574387-33574409 ACTTACTTCATTTCTTGTGCTGG - Intergenic
926866740 2:17367997-17368019 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
927408646 2:22800439-22800461 AGTTAAGCCTTTAATTTTGCAGG - Intergenic
928799561 2:35070652-35070674 AGTTATTTCTTTTCTTCTGCCGG - Intergenic
938222180 2:129579503-129579525 AGTTATGGCTATTATTGTGCTGG + Intergenic
938996387 2:136683270-136683292 AGCTCAGCCTTTTCTTGGGCAGG - Intergenic
939477911 2:142710266-142710288 AGTTACTTCTTGTCTTCTGCTGG + Intergenic
939566642 2:143793377-143793399 AGTTAAGCCTTTTCATGTTCAGG + Intergenic
941587310 2:167376860-167376882 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
943200753 2:184820500-184820522 AGGTCATCCTTTTCTTGTGCTGG - Intronic
946802063 2:223428651-223428673 CGTTACGTCTTTTCTTCTGCTGG + Intergenic
1170548766 20:17457446-17457468 AATTATGCCTTTTCTTGTGAAGG - Intronic
1171264228 20:23757511-23757533 AGTTACTTCTTGTCTTCTGCTGG - Intergenic
1173168697 20:40704828-40704850 AATTACGCATTTTGTTCTGCAGG - Intergenic
1180226330 21:46394801-46394823 AGTTACAGCTGTTCTTGGGCTGG + Intronic
1184199818 22:42960650-42960672 AGTTACGCCTTTTCTTGTGCTGG - Intronic
1184263869 22:43336174-43336196 AGTTTCTCCTTTGGTTGTGCGGG - Intronic
949347823 3:3093292-3093314 AGTTACTCCTTTTCCTAGGCTGG + Intronic
957523259 3:81348168-81348190 AGTTACTCCTTATATTGTGAAGG + Intergenic
957681599 3:83442877-83442899 TGTTACTTCTTTTCTTCTGCTGG - Intergenic
958800807 3:98753317-98753339 ACTTACAACTTTTCTTCTGCAGG - Intronic
959424074 3:106164376-106164398 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
960152818 3:114268132-114268154 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
960756718 3:121021892-121021914 GGTTATGACTTTTCTTCTGCTGG - Intronic
960769944 3:121182622-121182644 TGTTACTTCTTTTCTTCTGCTGG - Intronic
962333484 3:134502805-134502827 AGTTACTTCTTTTTTTCTGCTGG + Intronic
963461992 3:145626389-145626411 AGTTTTGCCTTTTCTTTGGCTGG + Intergenic
969693626 4:8722759-8722781 AGTTACGCCTGTGCTGATGCAGG + Intergenic
970153545 4:13117414-13117436 AGTTTTGCCTTTCATTGTGCTGG - Intergenic
973675794 4:53261250-53261272 TGTTATGTCTTTTCTTCTGCTGG + Intronic
978025253 4:103865507-103865529 AGAGCCTCCTTTTCTTGTGCTGG + Intergenic
978757684 4:112321364-112321386 TGTTATGTCTTTTCTTCTGCTGG + Intronic
981200927 4:141978777-141978799 AGTTTCTCCTTTTTTTGTGGGGG - Intergenic
981297041 4:143144440-143144462 AGGGCCTCCTTTTCTTGTGCCGG - Intergenic
982761612 4:159291141-159291163 AGGTACTCCTTTTCTAGTGACGG - Intronic
983036100 4:162867776-162867798 GGTTATTCCTTTTCTTCTGCTGG - Intergenic
989727754 5:44606950-44606972 GGTTATGTCTTTTCTTATGCTGG - Intergenic
990008530 5:50969061-50969083 AGGAACGCCTTTTTTTGTGAAGG + Intergenic
993445560 5:88007864-88007886 AGTTAAGCCTTATATTGTGGGGG + Intergenic
996608770 5:125354820-125354842 TGTTATGTCTTTTCTTTTGCTGG + Intergenic
1003481701 6:6539987-6540009 ACTTGCACCTTTTCTTCTGCAGG + Intergenic
1005152266 6:22765700-22765722 AGTTAGGCCTTCTCTTATGTGGG + Intergenic
1005155208 6:22797130-22797152 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
1010473324 6:76256456-76256478 AGTTATTTCTTTTCTTATGCTGG + Intergenic
1011427627 6:87247588-87247610 AGTTCTGCATTTTCTTCTGCAGG - Intronic
1011589287 6:88955657-88955679 TGTTACTTCTTTTCTTCTGCTGG - Intronic
1011846101 6:91564845-91564867 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1014591866 6:123283439-123283461 AGTTATTTCTTTTCTTCTGCTGG - Intronic
1016176136 6:141079842-141079864 TGTTACTTCTTTTCTTCTGCTGG - Intergenic
1016365788 6:143316623-143316645 GGTTACTTCTTTTCTTGTGCCGG - Intronic
1016618902 6:146084256-146084278 AGTTATGTCTTGTCTTCTGCTGG + Intronic
1021627757 7:22611280-22611302 GGTTATGCCTTTTCTTCAGCTGG - Intronic
1023301386 7:38775967-38775989 AGCCACCCCTATTCTTGTGCTGG + Intronic
1027691682 7:81354554-81354576 AGCTCAGCCTTTTCTTGGGCAGG + Intergenic
1040362451 8:46680105-46680127 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
1043545361 8:81309254-81309276 AGTTATTTCTTTTCTTCTGCTGG - Intergenic
1044196417 8:89381956-89381978 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
1044314687 8:90736143-90736165 AGGGAGTCCTTTTCTTGTGCTGG - Intronic
1047592338 8:126340240-126340262 TGTTATGTCTTTTCTTCTGCTGG - Intergenic
1048140129 8:131786093-131786115 AGTTTCCCGTTTTCTTGTGGGGG + Intergenic
1050810017 9:9733082-9733104 AGTTTAGCCTTTCATTGTGCAGG - Intronic
1051687411 9:19672554-19672576 TGTTATTTCTTTTCTTGTGCGGG + Intronic
1052040114 9:23728647-23728669 AGTTAAGCCTTTTCATTTCCTGG - Intronic
1052380119 9:27761327-27761349 AGTTTCTGCTTTTCTTGTCCTGG + Intergenic
1055811382 9:80152370-80152392 AGTTATTTCTTTTCTTCTGCTGG + Intergenic
1191024528 X:55899078-55899100 AGTGCCTCCTTGTCTTGTGCCGG - Intergenic
1191159646 X:57314907-57314929 AGTTATTTCTTTTCTTCTGCTGG - Intronic
1192876859 X:75239084-75239106 TGTTACTGCTTTTCTTCTGCTGG - Intergenic
1193775724 X:85639250-85639272 GGTTATTCCTTTTCTTCTGCTGG + Intergenic
1194544850 X:95220345-95220367 CGTTATTCCTTTTCTTCTGCTGG + Intergenic
1194727195 X:97412525-97412547 AGTTATTTCTTGTCTTGTGCTGG - Intronic
1194967602 X:100306536-100306558 GGTTATTTCTTTTCTTGTGCTGG - Intronic
1196273778 X:113742403-113742425 AGTTACGCCTTTTCTTGGCATGG - Intergenic
1197556555 X:127962544-127962566 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
1199315446 X:146372167-146372189 TGTTACTTCTTTTCTTCTGCTGG + Intergenic
1199932969 X:152543617-152543639 AGTTACTCTTTTTCTCTTGCAGG - Intergenic
1200081233 X:153577513-153577535 ATTTAGGCCTTTTCTGGTACAGG - Intronic
1201371194 Y:13266528-13266550 AGTTACTTCTTGTCTTCTGCTGG + Intronic