ID: 1184199822

View in Genome Browser
Species Human (GRCh38)
Location 22:42960679-42960701
Sequence CACCCTTCGAAGCCGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184199818_1184199822 6 Left 1184199818 22:42960650-42960672 CCAGCACAAGAAAAGGCGTAACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 75
1184199815_1184199822 16 Left 1184199815 22:42960640-42960662 CCCTTTGGATCCAGCACAAGAAA 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 75
1184199816_1184199822 15 Left 1184199816 22:42960641-42960663 CCTTTGGATCCAGCACAAGAAAA 0: 1
1: 0
2: 1
3: 34
4: 272
Right 1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184199822 Original CRISPR CACCCTTCGAAGCCGGGACA GGG Intronic
900096079 1:940634-940656 GACCCTGCGCAGCCGGGACTGGG + Intronic
900649318 1:3723255-3723277 CACCCTTTGAACCCGGCACAGGG + Intronic
901149757 1:7093373-7093395 CACCCTTGGAAGTCAGGAAATGG - Intronic
913256688 1:116960517-116960539 CACCCTTCTCTGCAGGGACATGG + Intronic
915469274 1:156115869-156115891 AACCCTTAGAACCCAGGACAAGG - Intronic
915724297 1:158006934-158006956 CACCCTGGCAAGGCGGGACAAGG - Intronic
919271928 1:195359754-195359776 CACCCTTGGAAGCCATGGCATGG + Intergenic
920969594 1:210731847-210731869 CACCCTGCCAAGCTGGGAGAAGG - Intronic
921317964 1:213909765-213909787 CATGCTTTGAAGCAGGGACAGGG + Intergenic
922831700 1:228557598-228557620 CACCCTTCCAAACCGGGTGAAGG - Intergenic
922832178 1:228609580-228609602 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922832738 1:228611821-228611843 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922833299 1:228614062-228614084 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922833859 1:228616303-228616325 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922834416 1:228618544-228618566 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922834976 1:228620776-228620798 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922835527 1:228622979-228623001 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922836085 1:228625221-228625243 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922836643 1:228627460-228627482 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922837202 1:228629702-228629724 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922837763 1:228631943-228631965 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922838321 1:228634183-228634205 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922838879 1:228636408-228636430 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922839439 1:228638649-228638671 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922840000 1:228640880-228640902 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922840560 1:228643121-228643143 CACCCTTCCAAACCGGGGGAAGG - Intergenic
922841123 1:228645352-228645374 CACCCTTCCAAACCGGGGGAAGG - Intergenic
924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG + Intergenic
924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG + Intergenic
1066044453 10:31583576-31583598 CACCCTGCAGAGCCAGGACAGGG - Intergenic
1074866219 10:117545710-117545732 CAGCCTTAGAAGCTGGGACGGGG - Exonic
1075786098 10:125051207-125051229 CACCATTCGAAAACGGTACATGG + Intronic
1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG + Intergenic
1086060264 11:82693093-82693115 CACCTTTGGAAGCAGAGACAAGG - Intergenic
1086473743 11:87147074-87147096 CACTCTGGGAAGCCGAGACAGGG + Intronic
1095364429 12:41385599-41385621 CACCCTTCCAAGACTGAACAAGG + Intronic
1096446581 12:51698336-51698358 CACCCTTCAAAGCCAGGATTAGG + Intronic
1098595876 12:72272762-72272784 CACCCTTCGCAGCCGCGATGGGG + Exonic
1099335202 12:81347562-81347584 CACCCCTCGAAGCCCTGCCAGGG - Exonic
1117339678 14:54782620-54782642 AACCCATCGATGCCGGAACATGG + Intronic
1129367353 15:75064513-75064535 CAACCCTCGAACCAGGGACAAGG + Intronic
1138353948 16:56362957-56362979 CATCCTTCGACGCAGGGTCACGG + Exonic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG + Intronic
1157668754 18:49510898-49510920 CACCCTGGGGAGCAGGGACAGGG - Intergenic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
946155939 2:217806650-217806672 GACCCTATGAAGCCTGGACAAGG + Intronic
1173062340 20:39674671-39674693 AACCCTTCAAAGCCAGGATAAGG + Intergenic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG + Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
953171795 3:40513892-40513914 CACTCTGTCAAGCCGGGACAGGG + Intronic
963750275 3:149170885-149170907 CACCCTTCTATTCCGGGAGAGGG + Intronic
968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG + Intergenic
969486773 4:7476730-7476752 CACCTCTCTAAGCAGGGACATGG + Intronic
973124843 4:46570535-46570557 CACCCTCCGAAGTCTGAACAAGG + Intergenic
980399141 4:132257443-132257465 CACCCTTCCAAGCCTGAACCAGG + Intergenic
991596929 5:68315799-68315821 CTCCCTTCAAAGCAGGCACAGGG + Intergenic
995695111 5:114870175-114870197 CACCCTTCCAAGACTGAACAAGG + Intergenic
997532018 5:134587234-134587256 CACCCATCCAACCCGGGACTGGG - Intergenic
1006003288 6:30983446-30983468 CACCCTTTGAAGCAGGGATCGGG - Intergenic
1006401042 6:33817560-33817582 CTTCCTTCCAAGCTGGGACACGG + Intergenic
1013472293 6:110476380-110476402 CACCCCGCGCAGTCGGGACACGG - Intronic
1013782100 6:113740049-113740071 CACTCTTCCAAGCCTGTACACGG + Intergenic
1017690979 6:156964044-156964066 CACCCTTGGAAGCAGTCACAAGG + Intronic
1022632150 7:32095364-32095386 CACCCTTCCATGGCCGGACATGG + Intronic
1023224977 7:37959838-37959860 CACCTTTCAAAGCCTGGAAATGG - Intronic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1035209723 7:157318850-157318872 CACCGTGCCCAGCCGGGACATGG - Intergenic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1039285121 8:36031479-36031501 CACCCTTCCAAGCCTAAACATGG + Intergenic
1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG + Intronic
1056764498 9:89436530-89436552 CACCCTTCAGCGCAGGGACAAGG + Intronic
1195105727 X:101600108-101600130 AACCCTTAGGAACCGGGACAGGG - Intergenic
1195107156 X:101613659-101613681 AACCCTTAGGAACCGGGACAGGG + Intergenic
1199720011 X:150536724-150536746 CACCCTGGGAAGCCTGGACTGGG - Intergenic