ID: 1184200182

View in Genome Browser
Species Human (GRCh38)
Location 22:42963195-42963217
Sequence GTACATTGTGGGCCGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184200182_1184200190 11 Left 1184200182 22:42963195-42963217 CCCTGCCCCGGCCCACAATGTAC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1184200190 22:42963229-42963251 AAGTGCAAATAAATAAAATGAGG 0: 1
1: 0
2: 5
3: 130
4: 1232
1184200182_1184200192 26 Left 1184200182 22:42963195-42963217 CCCTGCCCCGGCCCACAATGTAC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1184200192 22:42963244-42963266 AAATGAGGGACATCTCGTGCTGG No data
1184200182_1184200191 12 Left 1184200182 22:42963195-42963217 CCCTGCCCCGGCCCACAATGTAC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1184200191 22:42963230-42963252 AGTGCAAATAAATAAAATGAGGG 0: 1
1: 0
2: 7
3: 68
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184200182 Original CRISPR GTACATTGTGGGCCGGGGCA GGG (reversed) Intronic
900379220 1:2375562-2375584 GTACATGAAGGGCTGGGGCAGGG + Intronic
901624715 1:10617477-10617499 GTACAGTGGGGGCTGGGGCGGGG - Intronic
903153581 1:21429682-21429704 GGACATAGTGGGGCTGGGCAGGG + Intergenic
903224644 1:21887741-21887763 GTACAGGGTGGGCCTGGGGAGGG - Intronic
905023944 1:34837162-34837184 GTACATTCTTGGGCTGGGCACGG + Intronic
906245654 1:44271979-44272001 GGACATTGTGGGCAGGAGCTAGG - Intronic
913959997 1:143332082-143332104 GTGCATTTTGGGGCCGGGCATGG - Intergenic
914054354 1:144157655-144157677 GTGCATTTTGGGGCCGGGCATGG - Intergenic
914124792 1:144808706-144808728 GTGCATTTTGGGGCCGGGCATGG + Intergenic
916858297 1:168774757-168774779 GAAAAGTGTGGGCCAGGGCAGGG - Intergenic
918952196 1:191152737-191152759 GCACATTGTGGGGGGGGGCGGGG - Intergenic
919679056 1:200416094-200416116 GTACTTTATGGGCAGGGGCCAGG + Intergenic
920404151 1:205696631-205696653 GTACATTATGGGGCTGGGCATGG - Intergenic
922896692 1:229106231-229106253 GCAGATTGTGGACAGGGGCAGGG + Intergenic
1063309933 10:4942678-4942700 GTACATTTTGGGCTGGGAGAGGG + Intronic
1066001080 10:31104492-31104514 GTGCCTAGTGGGCTGGGGCATGG - Intergenic
1073923281 10:108483165-108483187 GTATATTGTTGGGCTGGGCATGG - Intergenic
1075834650 10:125443325-125443347 GTACTTTGTGAGCCTGGACAGGG - Intergenic
1075950774 10:126475952-126475974 GTGCTTTGTGGGCTGGGGCCAGG + Intronic
1076764893 10:132627656-132627678 GCACAGTGTGGTCCGGGGCTGGG + Intronic
1077415770 11:2423628-2423650 ATGCTGTGTGGGCCGGGGCAAGG - Intergenic
1077708630 11:4513556-4513578 CTACATTTTTGGCGGGGGCAGGG + Intergenic
1079833482 11:25301000-25301022 GTACAATTTGGGCCTGGGCCTGG + Intergenic
1080588233 11:33700160-33700182 CTACATTTCGGGTCGGGGCACGG + Intronic
1081895290 11:46580748-46580770 GTACATTGTGGGGAGGGGTTTGG - Intronic
1083944290 11:65915531-65915553 GTGAGTTGTGGGCTGGGGCAAGG + Intergenic
1084162358 11:67356693-67356715 GTATGTTGGGGGCCGGGGCCAGG - Intronic
1084164326 11:67367944-67367966 GTACATGGAGGGACGGGGCCAGG + Intronic
1090251769 11:125256494-125256516 GTGCATTTGGGGCCGGGGAAGGG + Intronic
1090738574 11:129634636-129634658 GCAGCTTGTGGGCCAGGGCAGGG - Intergenic
1091846240 12:3658221-3658243 GTAAATGCTGGGCCAGGGCATGG - Intronic
1093170736 12:15857444-15857466 GTTCATTGTGGGGCCGGGCACGG - Intronic
1094485740 12:30925298-30925320 GTTCAATGGGGGCCGGGGCCCGG - Intergenic
1097266167 12:57746021-57746043 GTAGATTATGGGACAGGGCAGGG - Intronic
1101324524 12:103703502-103703524 GTACCTTGTGTGCCTGGGAAAGG + Intronic
1101966774 12:109287369-109287391 GTCCAGGGTGGGCCGGGTCAGGG - Intronic
1103110949 12:118277747-118277769 ATACATGGTGGGCCCAGGCACGG - Intronic
1103524800 12:121560619-121560641 GTATAAAGTGGGCAGGGGCAGGG + Intronic
1104714456 12:131007119-131007141 TGACGTTGTGGGCCGTGGCACGG - Intronic
1104846658 12:131850434-131850456 CTACACTGTGGGACGTGGCAGGG - Intronic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1112285800 13:98103419-98103441 GTAAGATGTGGGACGGGGCATGG + Intergenic
1114546198 14:23503408-23503430 GTACACTGTGAGGCTGGGCATGG - Intronic
1116369030 14:44106626-44106648 GTACGTTGTTGGCAGGAGCATGG + Intergenic
1127518764 15:59722281-59722303 ATACAGTGGGGGCTGGGGCATGG + Intergenic
1129666336 15:77581654-77581676 GTTAGGTGTGGGCCGGGGCAGGG - Intergenic
1130223293 15:82039455-82039477 GAACATTGTGGGCAAGGTCAAGG - Intergenic
1132551144 16:554261-554283 GCACATCGTGGGCACGGGCAGGG + Exonic
1134463894 16:14456123-14456145 GTACAGTGTGGGGCTGGGTAAGG - Intronic
1135176487 16:20234200-20234222 GTTGATTGTGGGCCGGGGCGGGG - Intergenic
1136240789 16:28942556-28942578 CTACATTGTGAGCCAGGGCCTGG + Intergenic
1136341060 16:29643728-29643750 GTTCATTTTGGGCCCGGGCACGG - Intergenic
1142154960 16:88528662-88528684 GCACCTAGTGGGCCGGGGCCAGG - Intronic
1142171816 16:88626734-88626756 GTACATTGGGTACCGGAGCAAGG - Intronic
1146320931 17:31845901-31845923 GTACATTGTGGGCTGAAACAGGG - Intergenic
1148326474 17:46786150-46786172 CCAAATTGTGGTCCGGGGCATGG + Intronic
1148885718 17:50771277-50771299 ATACGTTTTTGGCCGGGGCACGG + Intergenic
1151009458 17:70476670-70476692 GTACATAGTGGGCCAAGTCAGGG + Intergenic
1152678490 17:81653628-81653650 GTGGATTGTGGGCCGGGGCGAGG - Intronic
1154102093 18:11485426-11485448 GTGCATGGTGGGCCAGAGCAAGG + Intergenic
1159014002 18:63086979-63087001 GTACCATCTGGGCTGGGGCATGG - Intergenic
1160790015 19:918896-918918 GCGCATGGTGGGGCGGGGCAGGG + Intronic
1160966935 19:1750787-1750809 GCAAATTGTGGGCAGGGGGAGGG - Intergenic
1161420781 19:4174987-4175009 GTGCATGGTGGCCCTGGGCAGGG + Intronic
1161439843 19:4284719-4284741 CTACCTTGGGGGGCGGGGCAGGG - Intronic
1162374155 19:10295266-10295288 GATCGTTGTGGGCCGGAGCAGGG + Intronic
1167866710 19:52335047-52335069 GCACTTTGGGGGCCGGGGCGTGG + Intergenic
1202693833 1_KI270712v1_random:110333-110355 GTGCATTTTGGGGCCGGGCATGG - Intergenic
926147610 2:10406230-10406252 GAACAGTGTGTGCCAGGGCATGG - Intronic
928041994 2:27887978-27888000 GTACTTTGTGGGGTGGGGTAGGG - Intronic
928213238 2:29339484-29339506 GGACCCTGTGGGCCGTGGCAAGG + Intronic
932115333 2:69041734-69041756 GAAAATTGTGGGCAGGGGCAAGG + Intronic
933952729 2:87344242-87344264 GTGCATTTTGGGGCCGGGCACGG + Intergenic
934236971 2:90240588-90240610 GTGCATTTTGGGGCCGGGCACGG + Intergenic
935561107 2:104561092-104561114 ATGGATGGTGGGCCGGGGCAAGG - Intergenic
938151154 2:128884077-128884099 GTACCCTGTGTGCCGGGGGAGGG + Intergenic
942122078 2:172787908-172787930 GTACTTTGTTAGCCAGGGCATGG - Intronic
1170861933 20:20113462-20113484 GTACAGTGTGGGCCTAGGAATGG - Intronic
1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG + Intronic
1172174854 20:32966105-32966127 GTGAGTTGTGGGCCCGGGCAGGG + Intergenic
1172647920 20:36483078-36483100 GTCCAGGGTGGGCTGGGGCAGGG + Intronic
1173548674 20:43917043-43917065 GTCCAGAGTGGGGCGGGGCAGGG + Intronic
1174402510 20:50283530-50283552 GGACAGTGTGGGCCAGGGCCTGG + Intergenic
1175593130 20:60209271-60209293 TGAGATTGTGGGCAGGGGCAGGG - Intergenic
1176365028 21:6027609-6027631 GTACAGTGTGGCCCAGAGCACGG - Intergenic
1178902951 21:36612389-36612411 GCACAGTGTGGGGCGGGGGAGGG + Intergenic
1178936290 21:36865093-36865115 GTCAGTTGTGGGGCGGGGCAGGG + Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1179454772 21:41491502-41491524 GAACATCGTGTGCCTGGGCATGG - Intronic
1179641107 21:42747658-42747680 TTACATTTAGGGCAGGGGCAGGG + Intronic
1179758490 21:43510936-43510958 GTACAGTGTGGCCCAGAGCACGG + Intergenic
1184200182 22:42963195-42963217 GTACATTGTGGGCCGGGGCAGGG - Intronic
952404615 3:32994322-32994344 CTACATTGTGAGGCCGGGCACGG + Intergenic
956910624 3:73812962-73812984 GTACATTGTGGGGTGGGGGGAGG - Intergenic
958024059 3:88029139-88029161 GTTCATTGTGGGCATTGGCATGG + Intergenic
958268015 3:91462731-91462753 ATACATTTTGGGGCTGGGCATGG - Intergenic
961550130 3:127665859-127665881 CTAAATTGGGGGCTGGGGCAAGG - Intronic
964403131 3:156320007-156320029 GCACACTGTGGGCAGGAGCAGGG + Intronic
965424975 3:168511408-168511430 GTGCATTGTGAGCTGGGTCAAGG - Intergenic
968235378 3:197027951-197027973 CTCCATGGTGGGCCGGGGCTGGG - Intronic
972267640 4:37478187-37478209 GTAAATTGTGGGGCAGGGTAGGG - Intronic
974009273 4:56592619-56592641 GACCCTTGCGGGCCGGGGCAGGG + Intronic
975386220 4:73763388-73763410 GTACATGATGGGGTGGGGCAGGG - Intergenic
981016743 4:139981388-139981410 GAACATTGTGGGCAGGGGTTGGG + Intronic
984713010 4:182901948-182901970 GGGCAGTGGGGGCCGGGGCAGGG - Intronic
985311631 4:188607436-188607458 TTAATTTGTTGGCCGGGGCAGGG + Intergenic
998977708 5:147666646-147666668 GTACATTGTGGGCCAGGAGCTGG + Intronic
1002341535 5:178519378-178519400 GCACATTGTGTGCCTGGTCATGG - Intronic
1006396007 6:33788358-33788380 GTACGTCCTGGGCCGGCGCAGGG - Intronic
1006594577 6:35183599-35183621 ATTCATTGTTGGCCGGGACATGG - Intergenic
1006772975 6:36569220-36569242 GGACATTTTGGGGCCGGGCACGG - Intergenic
1007061823 6:38947605-38947627 GGACACTGTGGGCAGGGGCAAGG + Intronic
1007681432 6:43636223-43636245 CTACAGTATGGGCCGTGGCAGGG - Intronic
1008987189 6:57558835-57558857 ATACATTTTGGGGCTGGGCACGG + Intronic
1009175148 6:60451402-60451424 ATACATTTTGGGGCTGGGCACGG + Intergenic
1010152555 6:72751230-72751252 GTACAGTGTGAGCCAAGGCATGG + Intronic
1011719077 6:90136534-90136556 GTAAATAGTGGGCCAGGGGAGGG - Intronic
1016575402 6:145564765-145564787 GTATATGGTGGGGGGGGGCAGGG + Intronic
1018508469 6:164496692-164496714 TTACATTGTGGGCGGGGGGGGGG - Intergenic
1018954875 6:168402701-168402723 GTACCCTGTGGGCTGGGGCAGGG - Intergenic
1020094699 7:5361843-5361865 GGGCCTGGTGGGCCGGGGCAGGG + Intronic
1022266085 7:28756260-28756282 GTACATTGAGTGGCTGGGCACGG + Intronic
1022328193 7:29352429-29352451 TAACATAGAGGGCCGGGGCACGG + Intronic
1025864068 7:65363737-65363759 GTATATTGTGGGGCCGGGCATGG + Intergenic
1028122963 7:87077894-87077916 GAACATTGGTGGCCGGGGGAAGG - Intergenic
1029223671 7:99009406-99009428 GTACTCTGTGGCCCAGGGCACGG + Intronic
1031535924 7:122932608-122932630 GGCCATGGTGGGCAGGGGCAGGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1047389489 8:124438551-124438573 ACACATTGTGGGGCCGGGCATGG + Intergenic
1049717698 8:144100694-144100716 GTTCAGTGGGGGCCGGGGCCGGG - Intronic
1050537810 9:6645516-6645538 GACCCTTGCGGGCCGGGGCAGGG - Exonic
1051189248 9:14493703-14493725 GTACATTCTGGTCCTGGGAAAGG - Intergenic
1052399518 9:27983001-27983023 GTTCATTGTGGGGAGAGGCAAGG - Intronic
1056633554 9:88313504-88313526 GTAATTTGTGGGCGGGGGCGGGG - Intergenic
1056992856 9:91426582-91426604 GTGGATTGAGGGCAGGGGCAAGG + Intergenic
1057230566 9:93319131-93319153 GTACATGGTGGTCAGTGGCACGG + Exonic
1058363643 9:104181271-104181293 GTACATTATGGGTCGGTGTAGGG + Intergenic
1058587047 9:106520025-106520047 ATACATTGTGGCTTGGGGCAAGG + Intergenic
1060158641 9:121338942-121338964 GTGCTTTGTGGGCCAGGGGAAGG - Intergenic
1060200129 9:121647481-121647503 GTACATCATGGGCCAGGCCAGGG - Intronic
1060273242 9:122162814-122162836 GAGGATTGTGGGCAGGGGCAAGG + Intronic
1060414132 9:123418859-123418881 GTTAATTATGGGCTGGGGCAGGG + Intronic
1062690181 9:137837586-137837608 GGACCAGGTGGGCCGGGGCAGGG + Intronic
1203792989 EBV:161483-161505 ATACTTTATGGGCCGGGGCGTGG - Intergenic
1187401638 X:18965600-18965622 GCACATTGTGGACAGGGACACGG + Intronic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1194234618 X:91366999-91367021 GTACATGGTGAGAGGGGGCATGG - Intergenic
1196843815 X:119882444-119882466 GTACATTGGGAGGCTGGGCACGG - Intergenic
1201961450 Y:19685076-19685098 GGACATGGTGGGCTGGGGGAGGG - Intergenic