ID: 1184202217

View in Genome Browser
Species Human (GRCh38)
Location 22:42978532-42978554
Sequence GAGGAGAAACACTGTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184202217_1184202222 14 Left 1184202217 22:42978532-42978554 CCCAGATGACAGTGTTTCTCCTC 0: 1
1: 0
2: 3
3: 46
4: 410
Right 1184202222 22:42978569-42978591 ACCCACACAGAGCAGAAAGCAGG No data
1184202217_1184202225 18 Left 1184202217 22:42978532-42978554 CCCAGATGACAGTGTTTCTCCTC 0: 1
1: 0
2: 3
3: 46
4: 410
Right 1184202225 22:42978573-42978595 ACACAGAGCAGAAAGCAGGAAGG 0: 1
1: 0
2: 9
3: 72
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184202217 Original CRISPR GAGGAGAAACACTGTCATCT GGG (reversed) Intronic
900355341 1:2259112-2259134 GAGGAGCCACCATGTCATCTGGG - Intronic
900999855 1:6143479-6143501 CAGAAGACACACTGTCTTCTAGG - Intronic
901397142 1:8989577-8989599 CAGGAGAATCACTTTCACCTTGG + Intergenic
901547102 1:9966204-9966226 CAGGAGAATCACTGTAACCTGGG + Intronic
902784296 1:18722998-18723020 GAGCAGAAACAATGTCTTATTGG - Intronic
904117184 1:28171565-28171587 GAGGAGAAATCCTGACCTCTGGG + Intronic
904154174 1:28468816-28468838 GAGCAGCATCAGTGTCATCTGGG - Intronic
904668508 1:32143478-32143500 GAGGAGAATCACTTGAATCTGGG + Intronic
905501078 1:38437520-38437542 GAGGAGAATCACTGGAACCTGGG - Intergenic
906182304 1:43832649-43832671 AAGGAGAAACATTTCCATCTTGG + Intronic
906357355 1:45118256-45118278 GAGGAGAAAAATAATCATCTTGG - Intronic
906379569 1:45323840-45323862 GAGCAGGAGCACTGCCATCTTGG + Intergenic
906611238 1:47205028-47205050 GAGGAGAATCACTTGAATCTGGG + Intergenic
906612551 1:47213413-47213435 GAGGGGGAACACTGGCTTCTAGG + Intergenic
908078427 1:60546519-60546541 GAGGAGAAAATCTCTCATCATGG + Intergenic
908208388 1:61874292-61874314 GAGGAGAACCACTTGAATCTGGG - Intronic
908720416 1:67119688-67119710 CAGCAGAAACACTGCCAGCTGGG + Intronic
908859184 1:68464143-68464165 CAGGAGAAACACTTGAATCTGGG - Intergenic
908971142 1:69833010-69833032 CAGGAGAATCACTGTAACCTGGG + Intronic
909119069 1:71577471-71577493 CAGGAGATACATAGTCATCTGGG - Intronic
909372156 1:74896655-74896677 CAGCAGCATCACTGTCATCTAGG + Intergenic
912134833 1:106648453-106648475 CAGCAGAAATACTGTCAACTTGG - Intergenic
912369911 1:109165835-109165857 GAGGAGAAACACTTGAACCTGGG - Intronic
913119131 1:115723628-115723650 TAAGAGAATCACTTTCATCTGGG - Intronic
914840420 1:151243763-151243785 CAGTAGAAACACTGCCATCTTGG - Intronic
915826755 1:159086320-159086342 GAGGAGAGACACTGACAACGAGG - Intronic
916689562 1:167177295-167177317 CAGCAGAAACACTGCCAGCTGGG - Intergenic
916847643 1:168669738-168669760 CAGTAGAAACACTGCCAGCTTGG + Intergenic
918156270 1:181849680-181849702 GAGGTGAAACCCACTCATCTGGG - Intergenic
918654477 1:187007079-187007101 GAGCAGGAGCACCGTCATCTTGG - Intergenic
918658142 1:187054367-187054389 GAGCAGGAGCACCGTCATCTTGG - Intergenic
918759141 1:188378556-188378578 GAGGAGAGAGACTGTTCTCTAGG + Intergenic
919020714 1:192101549-192101571 GAGCAGGAGCACTGTCATCTTGG - Intergenic
919586580 1:199447687-199447709 GGGGAGAAACCCACTCATCTGGG + Intergenic
921514727 1:216075696-216075718 GAGGATAATCACTTACATCTAGG - Intronic
921751390 1:218798380-218798402 GAGGAGAATCACTTTAATCCAGG - Intergenic
922381809 1:225036846-225036868 GAGCAGGAGCACTGTCATCTTGG - Intronic
922436367 1:225611409-225611431 GAGGAGAATCACTTGAATCTGGG - Intronic
923048559 1:230373499-230373521 GGGGAGAAACAGTGTCTTCCTGG - Intronic
923300234 1:232633431-232633453 CAGGAGAATCACTGGCACCTGGG - Intergenic
924312846 1:242763800-242763822 GGAGAGAAACACTGTCCACTTGG + Intergenic
924507676 1:244701413-244701435 TAGCAGAAACACTGCCAGCTTGG + Intronic
1063229367 10:4048816-4048838 GAGAAGTAACACTGACAGCTGGG - Intergenic
1063419010 10:5896266-5896288 GAGGGGATAGACTGTCATCAAGG + Intronic
1064039257 10:11944399-11944421 CAGGAGAATCACTGGAATCTGGG + Intronic
1064085997 10:12347335-12347357 CAGGAGAATCACTGTAACCTAGG - Intergenic
1064234934 10:13565146-13565168 GAGCAGGAGCACTGTCTTCTTGG - Intergenic
1064855761 10:19765850-19765872 CAGGAGAATCACTGGAATCTGGG + Intronic
1065069677 10:22009833-22009855 CAGGAGAATCACTTTAATCTGGG + Intergenic
1065811564 10:29448236-29448258 GAGGAGAAACTAGGTCATGTAGG - Intergenic
1066153725 10:32651931-32651953 GAGCAGAAGCATTGCCATCTTGG - Intronic
1067400664 10:45971051-45971073 CAGGAGAATCACTGGCATCCGGG - Intergenic
1067513545 10:46915744-46915766 CAGGAGAATCACTGGAATCTGGG + Intronic
1067648707 10:48136098-48136120 CAGGAGAATCACTGGAATCTGGG - Intergenic
1068919633 10:62469249-62469271 GAGTAGAAACATTGTCATGGTGG - Intronic
1072704544 10:97671237-97671259 GAGGAGAAACTGTGTCCTCATGG + Intronic
1074074090 10:110104477-110104499 CAGCAGAAACACTGTAAGCTTGG - Intronic
1074609783 10:115010397-115010419 CAGGAGAATCACTTTAATCTGGG + Intergenic
1075047199 10:119155447-119155469 TAGGAGAAACCCTGGGATCTTGG + Intronic
1075175973 10:120161322-120161344 GTGGAGAATCACTGTCATGAAGG + Intergenic
1075418802 10:122285714-122285736 GCTGAGAAACACTGTCATAGGGG + Intronic
1077426628 11:2482824-2482846 CAGCAGCAAGACTGTCATCTAGG + Intronic
1078044150 11:7898097-7898119 GAAGGGAAAGACTGTCATTTGGG - Intergenic
1078872801 11:15364618-15364640 GCAGAGAATCATTGTCATCTGGG - Intergenic
1079935209 11:26608491-26608513 GAGGGGAAACCCAGTCTTCTCGG + Intronic
1080141857 11:28931218-28931240 GAGCAGGAGCACTGTCATCTTGG - Intergenic
1080935002 11:36853668-36853690 GCAAAGAAACAATGTCATCTAGG - Intergenic
1081211176 11:40336363-40336385 GAGGAGAATCAATGGCATGTGGG - Intronic
1081979224 11:47256131-47256153 GAGGAGAATCACTTGAATCTGGG - Intronic
1082141029 11:48609845-48609867 GAGGAGAAATAGTATCATCAGGG + Intergenic
1082243996 11:49899382-49899404 GAGGAGAAACAGAGTCGTCAAGG - Intergenic
1083047427 11:59749369-59749391 GAGGAGAACCACAGTCAGGTGGG - Intronic
1083162563 11:60864010-60864032 GAGCAGGAGCACCGTCATCTCGG + Intergenic
1085119444 11:73957771-73957793 GAGCAGACACACAGGCATCTTGG - Intronic
1087096327 11:94322457-94322479 CAGGAGAATCACTGGAATCTGGG + Intergenic
1088147309 11:106697160-106697182 CAGAGGAAACACTGTCATGTTGG + Intronic
1089436199 11:118469834-118469856 GAAAAGAAAAACTGTCAACTTGG - Intronic
1090135159 11:124190343-124190365 GAGCAGGAACACCGTCATCTTGG + Intergenic
1090924754 11:131239711-131239733 GAGGAGGAACAGTGTCATTCTGG + Intergenic
1091200468 11:133776443-133776465 GATGAGAATCACTGTGATCTTGG + Intergenic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091497119 12:982221-982243 CAGCATAAACACTGTCATCTTGG - Intronic
1091794899 12:3292487-3292509 GTGGAGAAACCCTGTCATTGTGG + Intergenic
1092921899 12:13239667-13239689 GAGGAGAAACAATGTGAAATTGG + Intergenic
1094077516 12:26493734-26493756 GAGGACAATGTCTGTCATCTGGG + Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1095243410 12:39888110-39888132 GAGAAGTAACAGTGCCATCTGGG + Intronic
1096164897 12:49414148-49414170 GTTCAGAAACACTGTCATCTTGG - Intronic
1096421590 12:51463240-51463262 GAGGAATAAAACTGTCTTCTAGG + Intronic
1096534219 12:52260675-52260697 CAGCAGGAGCACTGTCATCTCGG - Intronic
1096646632 12:53041651-53041673 GCGGAGAAACACCTTGATCTTGG + Exonic
1097788015 12:63782542-63782564 GAGCAGAAACGCTGCCAGCTTGG - Intronic
1098031260 12:66257100-66257122 GAGTTGAGACACTGTCATTTTGG - Intergenic
1098709561 12:73738383-73738405 CAGCAGAAACACTGCCAACTGGG + Intergenic
1099122771 12:78712407-78712429 CAGTAGAAACACTGCCAGCTGGG - Intergenic
1099541140 12:83909000-83909022 CAGGAGAATCACTGGAATCTGGG + Intergenic
1099589973 12:84574980-84575002 GAGCAGGATCACCGTCATCTGGG + Intergenic
1099782596 12:87216447-87216469 GAGGAGAAAAACTGGCAGCTTGG + Intergenic
1100287150 12:93177784-93177806 GAGCAGGAGCACCGTCATCTTGG + Intergenic
1100588395 12:96000394-96000416 GAGGATAAGCACTTTAATCTGGG - Intergenic
1100939738 12:99713027-99713049 CAGCAGAAACACTGCCAGCTTGG - Intronic
1100941140 12:99723588-99723610 GAGGGGAAACCCACTCATCTGGG - Intronic
1101066652 12:101028250-101028272 GAAGAGAAACTCTGTCCTTTTGG - Intronic
1101713634 12:107291336-107291358 GATAAGAAACACCGTCAGCTTGG + Intergenic
1101932931 12:109029744-109029766 GAGTAGGAGCACCGTCATCTTGG - Intronic
1102557674 12:113738639-113738661 CAGCAGAAACACTGTCACCTTGG - Intergenic
1104106073 12:125660564-125660586 GCGCAGAAACATTTTCATCTGGG + Exonic
1104659450 12:130600193-130600215 GAGCAGGAGCACTGCCATCTTGG + Intronic
1104989432 12:132617100-132617122 CAGGAGAATCACTGGAATCTGGG - Intergenic
1105247696 13:18667429-18667451 CCGGAGAAAGACTGTCCTCTTGG - Intergenic
1105361771 13:19725082-19725104 CAGGAGAAACACTTGCACCTGGG + Intronic
1105794005 13:23832638-23832660 GAAGAGAAACAATGACCTCTGGG + Intronic
1106165733 13:27244406-27244428 GAGGAGCAGCAGTGTCACCTGGG + Intergenic
1106278812 13:28243779-28243801 CAGGAGAATCACTGTAATCTGGG - Intronic
1107148857 13:37089383-37089405 GAGAAAAAATACTCTCATCTTGG + Intergenic
1109084565 13:57952978-57953000 TAGAATAAACACTGTCATTTTGG + Intergenic
1109141951 13:58724190-58724212 GAGTAAAAACTCTGTCATCTTGG + Intergenic
1109511994 13:63389081-63389103 CAGGAGAATCACTGGAATCTGGG + Intergenic
1109644390 13:65234418-65234440 GAGGGAAAACTCTGTGATCTTGG - Intergenic
1110687224 13:78389202-78389224 GCCCACAAACACTGTCATCTAGG + Intergenic
1110986532 13:81977693-81977715 GAGCAGGAACACCATCATCTTGG + Intergenic
1111763781 13:92500131-92500153 CAGGAGAAGCCCTGTCATCTAGG + Intronic
1112086660 13:96039309-96039331 TATTAGAAACACTGTCAGCTTGG - Intronic
1113108463 13:106796834-106796856 AAGGAGAAACAATGACATCACGG - Intergenic
1113293079 13:108927201-108927223 TAGGAGAATCACTGGCATTTGGG - Intronic
1114488681 14:23081757-23081779 AAGGAGAAAGACGATCATCTAGG - Exonic
1114977236 14:28117098-28117120 GAAGAGAGACACTGTCTGCTTGG - Intergenic
1115574632 14:34698699-34698721 GAGGAGAATCACTTGCATCTGGG + Intergenic
1120739210 14:88089216-88089238 CAGGAGAATCACTTTAATCTGGG + Intergenic
1120923859 14:89779015-89779037 GAGGAGAAAAAGTGTCTTCCAGG - Intergenic
1121093159 14:91197057-91197079 CAGGAGAATCACTGGCACCTGGG - Intronic
1122298643 14:100719528-100719550 GAGGAGAAACACACACACCTGGG + Intergenic
1122434818 14:101688288-101688310 GAGCAGAAGCACTGCCATCTTGG + Intergenic
1124199255 15:27663212-27663234 GAGCAGGGGCACTGTCATCTTGG - Intergenic
1126642365 15:50840972-50840994 CAGCAGAAACACTGCCAGCTGGG - Intergenic
1126819085 15:52483474-52483496 GAAGAGAAAAAGTGACATCTGGG + Intronic
1127343479 15:58069537-58069559 GAGGAGAAACACTGTAAAGGTGG - Intronic
1127798904 15:62461039-62461061 CAGGAGAATCACTGGAATCTGGG - Intronic
1129508284 15:76101433-76101455 GAGGACAGACACTGTTATCCAGG + Intronic
1129865716 15:78906986-78907008 AAGGAGAAATTCTGTCATCCAGG + Intergenic
1129920395 15:79314734-79314756 GAGGAGAAACGGTGACATTTTGG + Intronic
1130019159 15:80212737-80212759 CAGCAGAAACACTGCCAGCTTGG + Intergenic
1131687236 15:94781363-94781385 GAGGACAAATATTGACATCTAGG + Intergenic
1133526847 16:6613843-6613865 GAGGAGAATCACTTGAATCTGGG + Intronic
1133647031 16:7774110-7774132 GAGGAGAATCACTTGAATCTGGG + Intergenic
1135237621 16:20772872-20772894 GAGGAGAATCACTTTAATCTGGG + Intronic
1135319366 16:21481536-21481558 CAGGAGAATCACTTTAATCTGGG + Intergenic
1135372203 16:21913012-21913034 CAGGAGAATCACTTTAATCTGGG + Intergenic
1135439583 16:22457692-22457714 CAGGAGAATCACTTTAATCTGGG - Intergenic
1135902068 16:26469776-26469798 GAGCAGGAGCACTGTCATCTTGG - Intergenic
1135931676 16:26743386-26743408 GAGGACAAACACTACCATGTGGG - Intergenic
1136054178 16:27675721-27675743 CAGGAGAAATACTGCCAGCTTGG - Intronic
1136329606 16:29563292-29563314 CAGGAGAATCACTTTAATCTGGG + Intergenic
1136388092 16:29942909-29942931 GAGCAAGAGCACTGTCATCTGGG + Intronic
1136444235 16:30302999-30303021 CAGGAGAATCACTTTAATCTGGG + Intergenic
1137885579 16:52099758-52099780 GAGCAAAAACCCTGTAATCTTGG - Intergenic
1137948635 16:52760467-52760489 GAGGAGAATCAGTGTGATATTGG + Intergenic
1138497240 16:57416040-57416062 GAGGATAAAGACTTTAATCTGGG - Exonic
1138721032 16:59079089-59079111 CAGGAGAAACACTGGAATCTGGG + Intergenic
1139091284 16:63651072-63651094 CAGGAGAATCACTGTAATGTGGG - Intergenic
1140213875 16:72992188-72992210 GCGGAGAAACGCTTTCATTTTGG - Intronic
1140243062 16:73220993-73221015 GGGGAGAAGCACTGTTATCAAGG + Intergenic
1140841859 16:78847088-78847110 GAGGCTTTACACTGTCATCTTGG + Intronic
1146359653 17:32163635-32163657 CAGGAGAATCACTATAATCTGGG + Intronic
1147257232 17:39188948-39188970 CAGGAGAAACACTTGAATCTGGG + Intronic
1148046893 17:44749859-44749881 GGGGACAAACACAGTCATTTTGG - Intronic
1148655771 17:49282264-49282286 CAGCAGAAACACTGTGAGCTTGG - Intergenic
1149195345 17:54113027-54113049 GAGCAGAAACATTGTCATGGTGG - Intergenic
1149630551 17:58118613-58118635 CAGGAGAATCACTGGAATCTGGG - Intergenic
1149799969 17:59558096-59558118 GAGCAGGAACATTGCCATCTTGG + Intergenic
1149835714 17:59910092-59910114 TAGGAGAAACACTGGAACCTGGG + Intronic
1150385796 17:64758982-64759004 GAGGAGAATCACTTGAATCTGGG - Intergenic
1151237292 17:72730189-72730211 AAGGAGAAACACAGTCATGGTGG - Intronic
1151446826 17:74171838-74171860 GATCAGAAACATTGTCATGTGGG - Intergenic
1152925306 17:83084910-83084932 GAGGAGAGACACTGTCAGCCAGG - Intronic
1152943882 17:83188088-83188110 CAGCAGAAACACTGCCAACTTGG + Intergenic
1152979618 18:264102-264124 GAGGAGAAACAATTTAATTTAGG + Intronic
1154353367 18:13605670-13605692 GAGCAGTAACACTGTCCTCCTGG - Intronic
1154441146 18:14391690-14391712 CCGGAGAAAGACTGTCCTCTTGG + Intergenic
1155360307 18:24993004-24993026 GAGGAGAAGCACTGACATATGGG + Intergenic
1155726197 18:29086824-29086846 GAGGAGATAAACTGATATCTGGG + Intergenic
1155969176 18:32065328-32065350 CAGGAGAATCACTTTAATCTGGG - Intronic
1156777529 18:40810825-40810847 GAAGACAGATACTGTCATCTGGG + Intergenic
1157024418 18:43825975-43825997 GAAGAGTAACACACTCATCTGGG - Intergenic
1157069399 18:44388258-44388280 GAGGGGAAATACTGACTTCTAGG + Intergenic
1157287376 18:46386156-46386178 GAAGAGAAACCCTGGCATGTAGG - Intronic
1157304429 18:46506922-46506944 GAGGGAACACACTGTCATCCAGG - Intronic
1157601379 18:48895013-48895035 GAGGAGAAATAATGGCATCGAGG - Intergenic
1158151583 18:54379350-54379372 GAGGAAAAACGCTATCATTTGGG - Exonic
1159203318 18:65217459-65217481 TAGGAGAAATAGTATCATCTTGG - Intergenic
1160925543 19:1543253-1543275 GAGGAGAATCACTTTCACCACGG + Intergenic
1161689754 19:5724604-5724626 CAGGAGAAACACTTGAATCTGGG + Intronic
1162051107 19:8033667-8033689 GAGCAGAAGCACTGTCATCTTGG - Intronic
1162204376 19:9044819-9044841 CAGGAGAATCACTTGCATCTGGG - Intergenic
1162588131 19:11573997-11574019 CAGGAGAATCACTTGCATCTGGG - Intronic
1162874026 19:13607568-13607590 CAGGAGAATCACTTTCACCTGGG + Intronic
1163086951 19:14988397-14988419 GAGCAGAAGCACCATCATCTTGG - Intronic
1163973201 19:20820603-20820625 GAGGAGTCACTCTGTCATCTTGG + Intronic
1167727195 19:51224541-51224563 GAGCAGGAGCACCGTCATCTCGG - Intergenic
1168182835 19:54674199-54674221 TAGCAGAATCACTGTCCTCTAGG + Intronic
1168366477 19:55792259-55792281 CAGTAGAAACACAGTCATCCAGG + Intronic
1168506564 19:56940046-56940068 GAGGACAGACAATGTCATCTGGG + Intergenic
1168534433 19:57157422-57157444 GAGGAGAATCACTTGAATCTGGG - Intronic
925624176 2:5825771-5825793 GAGGTGGAACAGTTTCATCTGGG - Intergenic
925807047 2:7660885-7660907 GAGGAGAAACACAGGGAACTTGG - Intergenic
926016594 2:9458309-9458331 CAGGAGAATCACTTGCATCTGGG + Intronic
926077411 2:9952053-9952075 GAGGAGAGACCCTGTCCTCGGGG + Intronic
926548371 2:14270401-14270423 GAGCAGGAACATTGCCATCTTGG - Intergenic
927815708 2:26215352-26215374 GAGGAGAAACAATATGCTCTAGG + Intronic
928217681 2:29375863-29375885 GAGGAGGAGCACTGCCATCTTGG + Intronic
930281068 2:49370438-49370460 AAGGAGAAACTCTGTCTTGTTGG - Intergenic
930599215 2:53424467-53424489 GAGCAGGAGCACCGTCATCTTGG - Intergenic
931151900 2:59583810-59583832 CAGGAGAATCACTTTCACCTGGG - Intergenic
932049915 2:68388214-68388236 GAGGAGAAACTCGCTCATCAAGG + Intronic
934514168 2:94974412-94974434 CAGGAGAATCACTGGAATCTGGG + Intergenic
934819092 2:97356494-97356516 GAGCAGAAGCATCGTCATCTTGG + Intergenic
936230367 2:110695091-110695113 GAGCAGGAACACTGTCATCTTGG + Intergenic
936286091 2:111182474-111182496 GAGAAGTAAAATTGTCATCTGGG - Intergenic
936784819 2:116081896-116081918 CAGTAGAAACATTGCCATCTTGG - Intergenic
936867129 2:117087568-117087590 GAGCAGGAGCACTGTCATCTGGG + Intergenic
937475210 2:122209051-122209073 GAAGAGGAACACAGTCCTCTTGG - Intergenic
937504550 2:122522398-122522420 GAGGAGAATTACTGGCATTTTGG + Intergenic
937570888 2:123359714-123359736 TAGCAGAAACACTGCCAGCTTGG - Intergenic
937703978 2:124896629-124896651 GAGGAGAATCACTGGAACCTAGG - Intronic
939113106 2:138031104-138031126 GAGGAGAAACAGTGGCTCCTGGG + Intergenic
939195124 2:138962268-138962290 TAGGAGAAACATTGGCATTTGGG + Intergenic
939610246 2:144301313-144301335 CAGGAGAATCACTTGCATCTGGG - Intronic
940488788 2:154330144-154330166 AAGGAGACACAATCTCATCTAGG + Intronic
941694328 2:168534777-168534799 GTGGGGAAACACAGTCATCTGGG + Intronic
941843158 2:170109197-170109219 GATCAGAAACACTGACCTCTTGG + Intergenic
942529334 2:176891820-176891842 GATTAGCAACACTGTCATCTTGG - Intergenic
942842594 2:180380620-180380642 TAGCAGAAACACTGCCAGCTGGG + Intergenic
944776350 2:202969480-202969502 CAGGAGAATCACTGGAATCTGGG + Intronic
944810540 2:203323388-203323410 CAGGAGAATCACTTGCATCTGGG - Intergenic
945320337 2:208414259-208414281 GAGCAGGAGCACTGTCATCTTGG - Intronic
945326835 2:208491949-208491971 GAGCAGAAGCACCATCATCTTGG - Intronic
945687639 2:212991647-212991669 CAGGAGAATCGCTTTCATCTGGG - Intergenic
945775937 2:214105826-214105848 GAGGAGATTCACTTTTATCTTGG + Intronic
945939403 2:215933021-215933043 CAGGAGAAACACTCTAATCCGGG + Intergenic
947428530 2:230005758-230005780 CAGGAGAATCACTGGAATCTGGG - Intronic
947660743 2:231865005-231865027 GAGGAGAATCACTTGAATCTGGG - Intergenic
947888045 2:233591789-233591811 CAGGAGAATCACTTGCATCTGGG + Intergenic
1169153978 20:3313662-3313684 GAGCAGAAACACTGCCAGTTTGG + Intronic
1169415488 20:5412750-5412772 GATGAGAAAGACTGTCATGATGG + Intergenic
1171433830 20:25104214-25104236 GAGGAGTACCTCTGTCACCTGGG + Intergenic
1172036504 20:32014627-32014649 CAGGAGCTACACTGTCACCTGGG + Intronic
1172172756 20:32950926-32950948 GAGCAGGAGCACCGTCATCTCGG - Intronic
1172530511 20:35627630-35627652 CAGGAGAATCCCTCTCATCTGGG - Intronic
1172750924 20:37250577-37250599 CAGGAGAAACACTGGAACCTGGG + Intergenic
1173145166 20:40518602-40518624 GAGGAGAAAGAATGGCTTCTGGG + Intergenic
1173447951 20:43137257-43137279 GAGAAAGAACACTGACATCTTGG - Intronic
1175239437 20:57535978-57536000 GAGCAGGAGCACTGACATCTCGG + Intergenic
1175944521 20:62552503-62552525 GAGGAGCAACAGAGTCATGTTGG + Intronic
1176165617 20:63671974-63671996 CAGGAGAATCGCTTTCATCTGGG - Intronic
1176454911 21:6899485-6899507 CCGGAGAAAGACTGTCCTCTTGG - Intergenic
1176833084 21:13764533-13764555 CCGGAGAAAGACTGTCCTCTTGG - Intergenic
1176891119 21:14320773-14320795 GAGTAGAAATGCTGGCATCTGGG - Intergenic
1177956730 21:27607009-27607031 GAGGAGAAACACTTGAATCCAGG - Intergenic
1178335418 21:31738260-31738282 CAGGAGAATCACTGGAATCTGGG - Intergenic
1179025434 21:37675472-37675494 GATGAGCACCACTGTCATCGCGG + Intronic
1181101432 22:20542739-20542761 CAGCAGAAACACTGCCAGCTTGG - Intronic
1182938893 22:34254990-34255012 GGGGAGAAACCCACTCATCTGGG + Intergenic
1183854437 22:40620836-40620858 CAGCAGAAACACTGTCAACTTGG + Intronic
1183917948 22:41138254-41138276 CAGGAGAATCACTGGCACCTGGG - Intronic
1184202217 22:42978532-42978554 GAGGAGAAACACTGTCATCTGGG - Intronic
1184307720 22:43618007-43618029 CAGGAGAATCACTGGAATCTGGG + Intronic
1185058361 22:48592779-48592801 GAGCAGAAACACAGTTTTCTGGG + Intronic
949454093 3:4219972-4219994 GAGTAGAAAGACTGGCGTCTAGG + Intronic
950068652 3:10134559-10134581 GAGCAGGAGCACTGTCATCTTGG + Intergenic
950740163 3:15044394-15044416 GAGGAGAAAGACTATCACCCTGG - Exonic
950818596 3:15733288-15733310 AAGGAGAAATACTGTCATATGGG + Intronic
951112800 3:18824413-18824435 CAGCAGAAACATTGTCAGCTTGG - Intergenic
952006705 3:28849573-28849595 GATGAGCAACATTATCATCTGGG + Intergenic
952352875 3:32557427-32557449 CAGGAGAAACACTTGAATCTAGG + Intronic
952688153 3:36173156-36173178 AAGGAGAAACACTTCCAACTAGG - Intergenic
953232768 3:41079243-41079265 GATGAGAAACCCTGACCTCTGGG + Intergenic
954101513 3:48376591-48376613 TGAGAGAAACACTGTCAGCTTGG + Intronic
954165068 3:48750268-48750290 CAGGAGAATCACTTTAATCTGGG + Exonic
954330171 3:49885625-49885647 GAGAAGAAACACTGTGATCCAGG + Intergenic
954958158 3:54540257-54540279 GGGGAGAAACGCTGTTATCCAGG - Intronic
955173827 3:56592163-56592185 TAGGAGAACCTCTGTCTTCTAGG - Intronic
955405333 3:58622346-58622368 CAGGAGAATCACTTTAATCTGGG + Intronic
955936570 3:64108423-64108445 CTGGAGAGATACTGTCATCTGGG + Intronic
959418320 3:106104099-106104121 GAGGGGAAACCCACTCATCTGGG + Intergenic
960488815 3:118284827-118284849 GGGGAGAAACACAGTCAAATTGG - Intergenic
961342229 3:126234580-126234602 AAGGACAAAGACTGTCATATTGG - Intergenic
961796576 3:129413219-129413241 GAGCAGGAGCACCGTCATCTGGG + Intronic
962582819 3:136813607-136813629 CAGGAGAATCACTGGAATCTGGG - Intergenic
962826020 3:139101610-139101632 CAGGAAAAACACTGTCTTCTAGG - Intronic
963879432 3:150512385-150512407 CAGGAGAATCACTTGCATCTGGG + Intergenic
964897468 3:161614968-161614990 TAGCAGAAACACTGCCAGCTTGG - Intergenic
964941960 3:162169328-162169350 GAGGAAAAAATCTGTCTTCTGGG + Intergenic
965103197 3:164329108-164329130 GAGCAGGAGCACTATCATCTTGG - Intergenic
965770393 3:172175793-172175815 CAGGAAAAACAATGTCTTCTGGG - Intronic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
966568098 3:181405829-181405851 GAGAAGAAAAACTGACATTTTGG + Intergenic
966813480 3:183869298-183869320 CAGGAGAATCACTTGCATCTGGG - Intronic
967541261 3:190670370-190670392 GAGGAGAAACAGTATCTTCAAGG + Intergenic
967872155 3:194239267-194239289 CAGGAGGAACACTTGCATCTAGG - Intergenic
967885404 3:194330280-194330302 GATGTGAAACGCTGTCATCGAGG + Intergenic
968216588 3:196896889-196896911 TAAGTGAGACACTGTCATCTAGG + Intronic
969044122 4:4324110-4324132 GAGCAGGAGCACTGTCATCTTGG + Intergenic
970467810 4:16344817-16344839 CAGCAGAAATACTGCCATCTTGG - Intergenic
970810181 4:20083588-20083610 GAGGAGAATCACTTGAATCTGGG - Intergenic
971111397 4:23590011-23590033 CAGCAGAAACACTGCCAGCTGGG - Intergenic
972908658 4:43785468-43785490 AAGCAGAAACACTGTCAGCTTGG + Intergenic
973705303 4:53575072-53575094 CAGGAGAATCACTTGCATCTGGG - Intronic
974918576 4:68207693-68207715 GAGGAGAATCACTTGAATCTGGG + Intergenic
975510609 4:75190717-75190739 GAGGAGTAACATAGTTATCTAGG + Intergenic
975601708 4:76106878-76106900 GAGCAGGAGCACCGTCATCTTGG - Intronic
975922400 4:79407900-79407922 GAGGGAAACCACTGTAATCTGGG - Exonic
976138349 4:81962845-81962867 GAGGAAAAACACTGTGCTGTGGG - Intronic
976298586 4:83496521-83496543 GAGCAGGAGCACCGTCATCTCGG - Intronic
976374090 4:84324619-84324641 CAGGACAAACACTGTCATAATGG + Intergenic
977054469 4:92173397-92173419 GAGCAGGAGCACCGTCATCTTGG - Intergenic
978836942 4:113162256-113162278 GAGGATAAGCAGTGTCATCAGGG - Intronic
982007803 4:151079958-151079980 CAGGAGAATCACTTTCACCTGGG - Intergenic
982891915 4:160864573-160864595 GACTAGAAACACTGTCAACATGG - Intergenic
983465676 4:168085935-168085957 TAGAAGAAACATTGTGATCTTGG + Intergenic
983479247 4:168253257-168253279 AAGGAGAAACAGAGTTATCTTGG - Intronic
983680486 4:170347650-170347672 GAGCAGGAGCACCGTCATCTCGG - Intergenic
983879926 4:172921700-172921722 CAGGAGAATCACTTTCACCTGGG + Intronic
984343643 4:178491070-178491092 GGAGAGAGACACTGTCTTCTTGG + Intergenic
984817115 4:183849202-183849224 GAGGTGAAACTCTGTTATTTAGG + Intergenic
985880422 5:2635135-2635157 GAGGAGAAGCTCTAACATCTGGG - Intergenic
986616854 5:9626485-9626507 CAGGAGAATCACTGGAATCTGGG - Intergenic
987120330 5:14761164-14761186 TATGAGGAAGACTGTCATCTAGG - Intronic
987712657 5:21522074-21522096 CAGGAGAAACACTGCCAGTTGGG - Intergenic
987817833 5:22927261-22927283 CAGGAGAATCACTTTAATCTGGG - Intergenic
988301721 5:29438419-29438441 CAGGAGAAACACTGCCAGTTGGG + Intergenic
988480891 5:31629576-31629598 GAGGAGAATCACTGGAACCTGGG + Intergenic
988840022 5:35074367-35074389 CAGGAGAATCACTGGAATCTGGG + Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
991269274 5:64760249-64760271 GAGCAGGAGCACTGTCATCTGGG + Intronic
991763019 5:69941221-69941243 CAGGAGAAACACTGCCAGTTGGG - Intergenic
991784307 5:70176908-70176930 CAGGAGAAACACTGCCAGTTGGG + Intergenic
991842246 5:70816261-70816283 CAGGAGAAACACTGCCAGTTGGG - Intergenic
991876754 5:71177292-71177314 CAGGAGAAACACTGCCAGTTGGG + Intergenic
992942442 5:81775312-81775334 GAGGAGAAACACTTTCAAGTGGG + Intergenic
993227366 5:85184327-85184349 CAGCAGAAACACTGCCAACTTGG + Intergenic
993303637 5:86247208-86247230 GAGTAGAAGCACTGACAGCTTGG - Intergenic
994611787 5:102050225-102050247 CAGGAGAAACACTTGAATCTGGG + Intergenic
994624559 5:102201854-102201876 CAGGAGAAAAATTGACATCTAGG + Intergenic
994706106 5:103208421-103208443 AAGGAGATTCACTGTCACCTTGG - Intronic
995264554 5:110142707-110142729 GAAGAGAAATACTGTAATCTTGG - Intergenic
995574477 5:113514314-113514336 GGGGAAAAACACTTTCAGCTAGG - Intronic
997213713 5:132093811-132093833 GAGCAGAATCAGTATCATCTGGG + Intergenic
997293068 5:132751693-132751715 GAATGGAAACATTGTCATCTAGG + Exonic
997499296 5:134359152-134359174 GAGGAGGAGCACCGTCATCTCGG + Intronic
997800828 5:136860016-136860038 GGGGATAAAAAATGTCATCTTGG - Intergenic
998258763 5:140611578-140611600 GAGCAGGAGCACTGTCATCTTGG - Intergenic
998593361 5:143501414-143501436 GAGGATGAACACTGTCCTGTGGG - Intergenic
998899492 5:146837967-146837989 GAGAAGAGACACTGCCATGTAGG - Intronic
1000465114 5:161566296-161566318 GAGAAGCAACACTGACAGCTCGG - Intronic
1001521415 5:172396279-172396301 CAGGAGAATCACTCGCATCTGGG + Intronic
1002649228 5:180679528-180679550 GAGCAGGAGCACCGTCATCTCGG + Intergenic
1004501518 6:16214280-16214302 GAGGAGAATCACTGGAACCTGGG - Intergenic
1005301873 6:24478953-24478975 GAGCAGAAGCATTGCCATCTTGG + Intronic
1005748598 6:28862968-28862990 CAGGAGAATCACTTGCATCTGGG + Intergenic
1005935426 6:30517515-30517537 CAGGAGAATCACTTGCATCTGGG - Intergenic
1007563106 6:42826877-42826899 GAGGAGAATCACTTGAATCTGGG - Intronic
1009004996 6:57774317-57774339 CAGGAGAAACACTGCCAGTTGGG + Intergenic
1009316663 6:62229054-62229076 GGGGGGAAACACAATCATCTGGG + Intronic
1011791394 6:90902836-90902858 GAGGAGAATCACTTGAATCTTGG + Intergenic
1012971392 6:105735539-105735561 GAGAAGAAACATGGTCACCTGGG + Intergenic
1014808508 6:125858796-125858818 GAGGTGACAAACTCTCATCTTGG + Intronic
1017269359 6:152488818-152488840 GAGTAGAAACACAGTCCTGTGGG + Intronic
1017674452 6:156798394-156798416 GAGGGGAAAGCCTGTCACCTAGG - Intronic
1017887676 6:158612274-158612296 GAGCAGGAGCACCGTCATCTTGG - Intronic
1018634721 6:165850601-165850623 GAGGAGCGACACTGGCAGCTGGG + Intronic
1018684703 6:166295022-166295044 GAGTTGGAGCACTGTCATCTTGG + Intergenic
1018748313 6:166779987-166780009 AAGGGGGAGCACTGTCATCTTGG - Intronic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1018985516 6:168633722-168633744 GAGCAGAGACACTGTCATTTTGG + Intronic
1020586941 7:10080269-10080291 GAGCAGAAGCACCATCATCTTGG + Intergenic
1020635475 7:10691439-10691461 GAGGAGAATCACTTGAATCTGGG + Intergenic
1020731478 7:11886700-11886722 GAGCAGGAACACTGTCATGATGG + Intergenic
1020767367 7:12340685-12340707 GAGCAGGAGCACCGTCATCTTGG - Intronic
1021029189 7:15708524-15708546 GAAGAGAAACACAGTAATCAAGG - Intergenic
1021032954 7:15761609-15761631 TTTGAGAAACACTGTCATTTTGG - Intergenic
1022681117 7:32547114-32547136 GAGGTGACACACAGACATCTGGG + Intronic
1022826853 7:34023418-34023440 GAGGAGAACCACTGCCACCGTGG + Intronic
1023028198 7:36070913-36070935 GATGAACAACACTGTCATCCGGG + Intergenic
1023137078 7:37063599-37063621 GAAGAGAAAGACTGTGATCATGG - Intronic
1023432494 7:40109256-40109278 GAGGAGAATCACTTGAATCTTGG - Intergenic
1024496705 7:50056672-50056694 GAGCAGGAGCAGTGTCATCTCGG + Intronic
1024959369 7:54958385-54958407 GAGGAGAACCACTGGAACCTAGG + Intergenic
1025618678 7:63147529-63147551 GAGGAGAATCACTCTAACCTGGG + Intergenic
1026069050 7:67101388-67101410 GAGCAGGAGCACCGTCATCTCGG - Intronic
1026136302 7:67664322-67664344 GAGCAGGAGGACTGTCATCTCGG - Intergenic
1026287299 7:68974518-68974540 CAGGAGAATCACTTACATCTGGG - Intergenic
1028278132 7:88884522-88884544 GAGGAGAATCAAGGTCATATAGG - Intronic
1028418095 7:90601060-90601082 GAGGAGCATCACTTTCATCTAGG + Intronic
1028967772 7:96821590-96821612 CAGAAGAAAACCTGTCATCTAGG - Intergenic
1029303491 7:99602076-99602098 GGAAAGAAAGACTGTCATCTTGG + Intronic
1029426563 7:100498091-100498113 CAGGAGAATCACTTGCATCTGGG + Intergenic
1030412399 7:109197967-109197989 TAGCAGAAACACTGCCAGCTTGG + Intergenic
1030920530 7:115379468-115379490 GATGAAAAACATTGGCATCTTGG - Intergenic
1031140474 7:117937017-117937039 GAGGAGAATCACTTGAATCTGGG + Intergenic
1032223739 7:130013661-130013683 CAGGAGAAAGACTCTCTTCTGGG + Intergenic
1033029206 7:137808656-137808678 GAGGAGACAGACAGTCATCTGGG + Intronic
1033117221 7:138636009-138636031 CAGGAGAATCACTTGCATCTGGG - Intronic
1034400122 7:150856664-150856686 GATGAGAAACACGGTGTTCTTGG - Exonic
1036132363 8:6127577-6127599 AAGGAAAAACTCAGTCATCTGGG + Intergenic
1036832601 8:12033370-12033392 GAGAAATAACACTGTCATCCAGG - Intergenic
1037385379 8:18334324-18334346 CAGGAGAAACACTTGAATCTGGG + Intergenic
1037838221 8:22227109-22227131 CAGGAGAAACAGGGCCATCTGGG - Intronic
1041904705 8:63019747-63019769 GAGGAGGAACATTGTCATGCTGG - Intronic
1042502317 8:69523073-69523095 GAGGAGAAGCATGATCATCTGGG + Intronic
1043452360 8:80380712-80380734 CAGGAGAATCACTTGCATCTGGG + Intergenic
1043851548 8:85221736-85221758 GAGCAGGAGCACCGTCATCTCGG - Intronic
1044038600 8:87337250-87337272 GGGGGGAAACACACTCATCTGGG + Intronic
1046221300 8:111218930-111218952 GAGGAGGAGCACTGTCATTTTGG + Intergenic
1046234081 8:111398393-111398415 GAGCAGGAGCACCGTCATCTTGG - Intergenic
1047637339 8:126778958-126778980 GAGCAGAAGCACCGTCATCTTGG + Intergenic
1048983662 8:139717329-139717351 GAAGACAAATACTGTCATATTGG + Intergenic
1050467997 9:5952111-5952133 GAGGAGAATCACTTGAATCTGGG - Intronic
1050720453 9:8583068-8583090 GAGGTGGAACAGTTTCATCTTGG - Intronic
1050923002 9:11229565-11229587 GAGCAGGAACATTGCCATCTTGG - Intergenic
1051664439 9:19455501-19455523 CAGGAGAATCACTTTCACCTGGG + Intergenic
1052199791 9:25764152-25764174 GAGGGGAAACCCCCTCATCTGGG - Intergenic
1053641919 9:40091417-40091439 GAAGATAAACATTGTCAGCTGGG + Intergenic
1053764218 9:41374042-41374064 GAAGATAAACATTGTCAGCTGGG - Intergenic
1054322813 9:63688811-63688833 GAAGATAAACATTGTCAGCTGGG + Intergenic
1054542830 9:66285225-66285247 GAAGATAAACATTGTCAGCTGGG - Intergenic
1055161361 9:73132362-73132384 CAGCAGAAACACTGTCATCTTGG - Intergenic
1056745159 9:89295347-89295369 GAGCAGGAGCACCGTCATCTGGG + Intergenic
1057073340 9:92119513-92119535 CAGAAGAAACACTGTCAGCTTGG - Intergenic
1057308150 9:93924524-93924546 GAGGACAAACCCTGCCATCCCGG + Intergenic
1058513238 9:105742072-105742094 CAGAAGAAACACTGCCAGCTTGG + Intronic
1060762652 9:126268923-126268945 GAAGAGAAACATTGAGATCTTGG - Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1186014780 X:5179224-5179246 GACGAGAATCACTGTGTTCTTGG + Intergenic
1190122732 X:47675921-47675943 GAGCAGGAGCACCGTCATCTTGG + Intergenic
1190408151 X:50108283-50108305 AAGCAGAAACACTGTTAGCTTGG - Intergenic
1190580740 X:51891681-51891703 GAGGAGAAACACTGTGTTGGTGG + Intronic
1191663561 X:63674922-63674944 GAGCAGGAGCACCGTCATCTTGG - Intronic
1192325027 X:70124382-70124404 GAGCAGGAACATTGCCATCTTGG - Intergenic
1192487020 X:71536511-71536533 AAGGAGAAAAACTGGCAGCTGGG - Intronic
1193337840 X:80312139-80312161 GAGCAGGAGCACCGTCATCTCGG + Intergenic
1193768498 X:85560973-85560995 GGGGGGAAACACACTCATCTGGG + Intergenic
1194248309 X:91541454-91541476 CAGGAGAATCACTGGAATCTAGG + Intergenic
1194786237 X:98087361-98087383 GAGGTGAAACAGTTTCATCCCGG - Intergenic
1196064515 X:111448170-111448192 GAGGAAAAAAAATGTCAGCTAGG + Intergenic
1196135603 X:112206531-112206553 GAGAGGAAACACTGTCAGATAGG - Intergenic
1196318546 X:114259999-114260021 GAGCAGAAACACTTTTAACTGGG - Intergenic
1197981632 X:132223527-132223549 CAGCAGCAACAGTGTCATCTGGG - Intergenic
1198861526 X:141075810-141075832 GATGAGAAACAATGGCAACTTGG + Intergenic
1198932248 X:141873567-141873589 GAGCAGGAGCACTGTCATCTTGG - Intronic
1199172661 X:144749339-144749361 GAGAAGAAACACTGGAGTCTTGG + Intergenic
1200245848 X:154524792-154524814 GAGGAGAATCGCTTTAATCTGGG + Intergenic
1200377488 X:155799087-155799109 GAGGAGAATATCTGTCACCTAGG + Intergenic
1200567321 Y:4782974-4782996 CAGGAGAATCACTGGAATCTAGG + Intergenic
1200882230 Y:8228322-8228344 GAGCAGGAGCACTGGCATCTTGG + Intergenic
1201356221 Y:13099438-13099460 GAGCAGGAGCACTGCCATCTTGG - Intergenic
1202099711 Y:21294575-21294597 GAAGAGGGACACTGTCCTCTAGG - Intergenic
1202112384 Y:21436121-21436143 CAGGAGAATCACTGGAATCTGGG - Intergenic