ID: 1184205558

View in Genome Browser
Species Human (GRCh38)
Location 22:43000224-43000246
Sequence GGGGTCCTGACCTGGAACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 336}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184205558_1184205574 27 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205574 22:43000274-43000296 TGCACAGGGAGTGGGTAGCAGGG 0: 1
1: 0
2: 3
3: 21
4: 259
1184205558_1184205570 13 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205570 22:43000260-43000282 CCTGGACAGCAGGATGCACAGGG 0: 1
1: 0
2: 2
3: 23
4: 247
1184205558_1184205571 18 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205571 22:43000265-43000287 ACAGCAGGATGCACAGGGAGTGG 0: 1
1: 0
2: 0
3: 35
4: 461
1184205558_1184205573 26 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205573 22:43000273-43000295 ATGCACAGGGAGTGGGTAGCAGG No data
1184205558_1184205565 3 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205565 22:43000250-43000272 AGCCAGCCATCCTGGACAGCAGG 0: 1
1: 0
2: 2
3: 35
4: 233
1184205558_1184205572 19 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205572 22:43000266-43000288 CAGCAGGATGCACAGGGAGTGGG 0: 1
1: 0
2: 4
3: 51
4: 423
1184205558_1184205561 -5 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205561 22:43000242-43000264 ACCCCAAAAGCCAGCCATCCTGG 0: 1
1: 0
2: 1
3: 13
4: 187
1184205558_1184205568 12 Left 1184205558 22:43000224-43000246 CCCGGGTTCCAGGTCAGGACCCC 0: 1
1: 0
2: 5
3: 36
4: 336
Right 1184205568 22:43000259-43000281 TCCTGGACAGCAGGATGCACAGG 0: 1
1: 0
2: 3
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184205558 Original CRISPR GGGGTCCTGACCTGGAACCC GGG (reversed) Intronic
900190850 1:1351612-1351634 GGGATCCTGACCCTGCACCCGGG + Intergenic
900405007 1:2489081-2489103 GGGGTCTTCACCAGGAACCCAGG - Intronic
900524990 1:3124186-3124208 GGGGTCCTGTCCTCGTACCCTGG + Intronic
900653342 1:3742152-3742174 GGGGCCCGGCCCTGGGACCCTGG + Intergenic
900844608 1:5086934-5086956 GGAGTACTGACCAGGAGCCCTGG + Intergenic
901797634 1:11689815-11689837 GGGGTCCTGACCCAGACCTCAGG - Intronic
901803035 1:11720234-11720256 GGAGCACTGACCTGGGACCCTGG - Exonic
902331692 1:15734093-15734115 GGGCACCTGATCTGGATCCCTGG - Exonic
903275236 1:22217424-22217446 TGGGGCCTGAACTTGAACCCAGG + Intergenic
904518836 1:31078214-31078236 GGGGTCTTGCCATGGTACCCAGG + Intergenic
905321191 1:37118624-37118646 TGGGGCCTGACCTGGGACCCTGG - Intergenic
905769074 1:40625745-40625767 GGGCACCTGGCCAGGAACCCTGG + Exonic
905869351 1:41394359-41394381 GGGCTCCTGCCCTGTCACCCTGG - Intergenic
907322162 1:53611108-53611130 AGGGTCCTGCCCTGTCACCCAGG + Intronic
907352806 1:53847211-53847233 GGAGTCCTGCCCTGTAGCCCAGG + Intergenic
908441534 1:64159880-64159902 GAGGTCCTGGCAAGGAACCCAGG + Intronic
910585464 1:88874337-88874359 GGGGTCTTGATCTGTCACCCAGG + Intronic
911598846 1:99825769-99825791 GGGGTCTTGGCCTGTCACCCAGG - Intergenic
913045290 1:115068934-115068956 TGGGGCTTGGCCTGGAACCCAGG - Intronic
915201260 1:154231155-154231177 GGGGTCTTGCCCTGTCACCCAGG + Intronic
915956658 1:160225867-160225889 GGGGTCCTGCTCTGTCACCCAGG + Intronic
916319889 1:163492326-163492348 GGGGTACTGGCCTGGAGCCTGGG - Intergenic
916747568 1:167696120-167696142 GGGGTGCTGAGCTGGAGACCTGG - Intronic
917899218 1:179525520-179525542 AGGGTCCTGCCCTGTCACCCAGG + Intronic
918093626 1:181317429-181317451 GAGGTCCAGAGCTGGAGCCCAGG + Intergenic
919092559 1:192992642-192992664 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
920302027 1:204994919-204994941 GGGGTTTTGTCATGGAACCCAGG - Intronic
920788433 1:209064996-209065018 GGGCTTCTCAGCTGGAACCCAGG - Intergenic
921747600 1:218754984-218755006 GGTTTCCTGACCAGGAAGCCAGG - Intergenic
923090828 1:230739853-230739875 GGGGTCCTGATCCAGACCCCAGG + Intergenic
923775517 1:236974844-236974866 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
1063568814 10:7195777-7195799 CAGGTCCTGTCCTGGAACCTGGG + Intronic
1064157460 10:12915898-12915920 TGGGTGCTGACCTGGCACCAGGG + Intronic
1064252217 10:13715181-13715203 GGGCTCCTGACCTCCCACCCAGG - Intronic
1064427295 10:15241005-15241027 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1064645212 10:17453761-17453783 GGGGACCTGGCCTGGGAGCCGGG - Intronic
1065349461 10:24782595-24782617 GGGGTCTTGCCCTGTCACCCAGG - Intergenic
1067114170 10:43422070-43422092 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
1067711744 10:48656014-48656036 GGGCTGCTCACCTGGAACCAGGG + Intronic
1068467662 10:57416203-57416225 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
1069572690 10:69503984-69504006 GGGGCCCTGCCCTGGACCTCAGG + Intronic
1072318118 10:94223032-94223054 AGGATCCTGCCCTGGACCCCAGG - Intronic
1072536826 10:96370472-96370494 GGAGCCCTGACCTGGGAGCCAGG - Intronic
1072788297 10:98299632-98299654 GGGGTTATTCCCTGGAACCCCGG + Intergenic
1073013909 10:100382962-100382984 GGTTTCCTCACCTGGAACTCTGG - Intergenic
1073084518 10:100879611-100879633 GGGTTCCCAACCTGGAACCAGGG + Intergenic
1074402372 10:113152677-113152699 TTGGTCCTGAGCTGGAACACTGG - Intronic
1074607649 10:114989536-114989558 GGGGTTCAGACCTGGATTCCTGG + Intergenic
1075371029 10:121935061-121935083 GGGGTCTTGATCTGTCACCCAGG - Intergenic
1076476066 10:130752288-130752310 GGGGTCCTGAGCTGGATCCCAGG + Intergenic
1076705884 10:132301420-132301442 CAGGGCCTGGCCTGGAACCCGGG + Intronic
1076837131 10:133026827-133026849 GGGGAGCTGACCTGGCAGCCGGG + Intergenic
1077018351 11:406764-406786 GGGGTCCCAGCCTGGAGCCCGGG + Intronic
1077366673 11:2164019-2164041 GAGGTCCTGTCCTGGCTCCCAGG - Exonic
1077977435 11:7262592-7262614 AGAGTGTTGACCTGGAACCCAGG + Intronic
1078452264 11:11449207-11449229 GGGGTCCTGACTTGAAGCCATGG - Intronic
1078840392 11:15072179-15072201 GGGATCTTCTCCTGGAACCCGGG + Intronic
1080637040 11:34133243-34133265 GGAGTCCTGGTCTGGAACCAAGG + Intronic
1081538068 11:44009737-44009759 AGGGTCCTGCCCTGTCACCCAGG - Intergenic
1081617447 11:44599174-44599196 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1082278961 11:50249054-50249076 GGGGTCCTGCTCTGTCACCCAGG - Intergenic
1083758720 11:64804624-64804646 GGGGTCCTGACACTGCACCCTGG + Exonic
1083804862 11:65067570-65067592 TGGGCCCTGACCTGAAAGCCAGG + Intronic
1084218584 11:67664649-67664671 GGGATCCTGGCCTGGAGCCCTGG - Intronic
1084269725 11:68022486-68022508 GGGATCCTGGCCTAGAGCCCTGG + Intronic
1085015964 11:73174185-73174207 GGCGTCCTGAGCTCGAGCCCAGG - Intergenic
1085407543 11:76272346-76272368 GGGGTCTTGTTCTGGCACCCAGG + Intergenic
1086514983 11:87601354-87601376 GGGAGCCTGACCTGGAACACTGG - Intergenic
1088419997 11:109635536-109635558 TGGGGCCTGGCCTGGAGCCCTGG + Intergenic
1089316162 11:117592800-117592822 TGGGTGCAGACCTGGCACCCGGG + Intronic
1091284246 11:134399268-134399290 TGGGTCCTGCCCTTGGACCCTGG + Intronic
1091629614 12:2149821-2149843 GGAGGCCTGACCTGGGGCCCAGG + Intronic
1091736188 12:2923953-2923975 GGGGTCCTGCTCTGTAACCCAGG - Intronic
1092132512 12:6122693-6122715 AGGGTGTTGGCCTGGAACCCAGG + Intronic
1095208189 12:39462307-39462329 GGGACCCTGACCTGGAACAAAGG + Intergenic
1095952207 12:47787747-47787769 GGGGTCCAGACCTCCAGCCCAGG + Exonic
1096798808 12:54095883-54095905 GGGATCCTGCCCCGGATCCCAGG - Intergenic
1098819940 12:75214315-75214337 GGAGTCTTGACCTGTCACCCAGG - Intergenic
1099254156 12:80295071-80295093 GGGGTCTTGCCCTGTCACCCAGG - Intronic
1099854285 12:88143735-88143757 GGTGTTCTGATCTGGACCCCAGG + Intronic
1101485972 12:105160371-105160393 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1101528892 12:105556753-105556775 GGGGTCCTGACCTGGAGGGAGGG - Intergenic
1101782143 12:107845826-107845848 GGGGCTGTGACCTGGGACCCCGG - Intergenic
1102226651 12:111233534-111233556 GAGGTCCTGCCCTGAGACCCAGG + Intronic
1102327596 12:112001337-112001359 GGGGTCCTGTTCTGTCACCCAGG + Intronic
1102993364 12:117330509-117330531 GGGGTCCTGGCCTGGGGGCCTGG + Exonic
1103846182 12:123903348-123903370 GGCCTGCTGACCTTGAACCCAGG + Intronic
1103966486 12:124643233-124643255 CAGGTCCTGAGTTGGAACCCTGG - Intergenic
1104360439 12:128128192-128128214 AGGGTCTTGACCTGTTACCCAGG + Intergenic
1104739710 12:131163807-131163829 GCGGTCCTGACCTGGGCCCGTGG - Intergenic
1105732179 13:23228894-23228916 AGGGTCCTGCCCTGTCACCCAGG + Intronic
1107020428 13:35745459-35745481 GGGGTCCTGATCCAGACCCCAGG + Intergenic
1107522416 13:41196371-41196393 GGGGTCTTGCCCTGTCACCCAGG + Intergenic
1107915597 13:45146471-45146493 AGGGTCTTGACCTGTCACCCAGG - Intronic
1109259339 13:60124747-60124769 GGGGGTCTGAGCTGGAGCCCAGG + Intronic
1109812803 13:67537300-67537322 GGAGTCCTGCCCTGTCACCCAGG - Intergenic
1110552754 13:76827001-76827023 GGATTCCTGACCTGGACCCACGG + Intergenic
1110565056 13:76949597-76949619 GGGGTGGTGACATGGAGCCCTGG - Intronic
1113029174 13:105975251-105975273 GGGGTCTTGCCATGGAATCCAGG - Intergenic
1113836793 13:113333251-113333273 GGGTTCCTCACGTGTAACCCGGG + Intronic
1114421796 14:22589819-22589841 AGGGTTCTGAACTGGAACTCGGG + Intergenic
1114451751 14:22831136-22831158 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1115805179 14:37043042-37043064 GGGGTCCTGACTTGGGCCACTGG - Intronic
1117991548 14:61438946-61438968 GGGGTGCTGGCCTGGAGCCCTGG - Intronic
1118360151 14:65049099-65049121 GGAGTCCTGCCCTGTTACCCAGG - Intronic
1119226479 14:72948211-72948233 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1120731591 14:88008917-88008939 GGGGTCCTCACTTGGAAACTAGG - Intronic
1121018937 14:90567116-90567138 GGGGTGCTGACCTGGAGCCAAGG - Intronic
1121042021 14:90757416-90757438 AGGGTCCTGCCCTGTCACCCAGG - Intronic
1124616396 15:31245372-31245394 GGGATCAGGACCAGGAACCCAGG + Intergenic
1124850812 15:33337029-33337051 GGAGTCCTGCTCTGTAACCCAGG - Intronic
1125625611 15:41106600-41106622 GGGGTCTTGCCCTGTCACCCAGG - Intronic
1126009097 15:44285511-44285533 GGGGTCTTGCCCTGTCACCCAGG - Intergenic
1126623828 15:50667015-50667037 GGGGTCCTGATCCAGACCCCAGG - Intronic
1127668662 15:61173679-61173701 GGGGTCCTGCTCTGCCACCCAGG + Intronic
1128035938 15:64526637-64526659 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1128435573 15:67644366-67644388 GGAGTCCTGCCCTGTCACCCAGG - Intronic
1128978510 15:72169836-72169858 GGGGTCCTCACCTGTAGTCCGGG + Exonic
1129009290 15:72400673-72400695 GGGGTCCTGATCCAGACCCCAGG + Intronic
1129117544 15:73373506-73373528 GGAGTCCTGACCTGGAGACAAGG + Intergenic
1129247760 15:74290201-74290223 GGAGTCCTGACCTGTTGCCCAGG + Intronic
1129301582 15:74628672-74628694 GGGGTCCTTACCTGGTACGGTGG - Exonic
1129792931 15:78353675-78353697 AGGGTCTTGCCCTGTAACCCAGG + Intergenic
1130293439 15:82624861-82624883 GGGGTCCTGCTCTGTCACCCAGG + Intronic
1131230390 15:90654761-90654783 GGGATCCTGGCCTGGAATCCAGG + Intergenic
1133113952 16:3565283-3565305 GGGGCCCTGAGCTTGTACCCCGG + Intronic
1133293306 16:4736912-4736934 TTGGTGCTGACTTGGAACCCAGG + Intronic
1133742984 16:8665358-8665380 GTGGGTCTGACCTTGAACCCTGG + Intergenic
1135428243 16:22358533-22358555 GGAATCCTAACCTGGAACGCAGG + Intronic
1135522130 16:23185901-23185923 GAGTTCCTGCCCAGGAACCCGGG + Intronic
1136235635 16:28911921-28911943 GGAGTCCTGTCCTGTCACCCAGG - Intronic
1136374542 16:29857674-29857696 GGGGTCCTGCCATGTGACCCAGG + Intergenic
1136390528 16:29961710-29961732 CGAGTCCTCACCGGGAACCCGGG + Intronic
1137768558 16:50996463-50996485 AGGATCCTGAGCAGGAACCCGGG - Intergenic
1138058203 16:53858684-53858706 GGGGTCTTGATCTGTCACCCAGG + Intronic
1138419518 16:56890205-56890227 GGGGAGGTGACCTGGCACCCAGG - Intronic
1138642884 16:58399259-58399281 GGGGTCCTGTTCTGTCACCCAGG - Intronic
1139764512 16:69215826-69215848 AGGGTCCTGATCTGTCACCCAGG + Intronic
1139956587 16:70696165-70696187 GGGTGCCTGACATGTAACCCAGG - Intronic
1140635015 16:76902135-76902157 GGGGTCCTGTCCCGGAAACTAGG + Intergenic
1140743322 16:77960743-77960765 GGGGTCCTGGGCTGCAACCTTGG - Intronic
1141310802 16:82911786-82911808 AGGCTCCTGTCCTGGAATCCTGG + Intronic
1141594979 16:85091868-85091890 GGGTTCCTTAGCTGGAAGCCAGG + Exonic
1141975896 16:87516243-87516265 GAGGTCCTCACCTGCAGCCCTGG + Intergenic
1142137898 16:88459981-88460003 GCTGCCCTGACCTGGAACCTGGG - Intronic
1142353166 16:89588944-89588966 CGAGGCCTGACCTGGAGCCCAGG - Intronic
1142884422 17:2903868-2903890 GGGGTCTGGGCCTGGAAACCTGG + Intronic
1143632867 17:8148762-8148784 GAGGTCCTGACCGGGATCCAGGG - Exonic
1143839797 17:9723166-9723188 GGGCTTCTCACCTGCAACCCTGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144766062 17:17733166-17733188 GGGTTCCTGCCCTGGCATCCTGG + Intronic
1144957874 17:19028616-19028638 GGTGTTCTGACCCTGAACCCAGG + Intronic
1144977284 17:19145904-19145926 GGTGTTCTGACCCTGAACCCAGG - Intronic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1145007625 17:19346439-19346461 CGGCTGCTGCCCTGGAACCCAGG + Intronic
1145091234 17:19987817-19987839 GGGGTCCTGATCCAGACCCCAGG - Intergenic
1146340299 17:32012989-32013011 GGGGTCTTGCCCTGTTACCCAGG - Intronic
1146914095 17:36667012-36667034 GGTTTCCTGACCTGAAAGCCTGG - Intergenic
1147182220 17:38693606-38693628 GGTGATCTGCCCTGGAACCCTGG - Intergenic
1147897007 17:43757630-43757652 GCAGGCCTGACCAGGAACCCAGG + Intronic
1150714491 17:67559780-67559802 GGGAGGCTGACCTTGAACCCAGG + Intronic
1151368407 17:73631609-73631631 GGGCTGCTGACCAGAAACCCTGG + Intronic
1151550354 17:74819149-74819171 AGGGGCCTGCCCTGGAAGCCAGG + Intronic
1152133719 17:78492119-78492141 GTGGTCCTGACCAGGAGCCTAGG - Intronic
1152228609 17:79103806-79103828 GGGGCCCGGACCTGGGGCCCAGG + Intronic
1152376490 17:79921320-79921342 TGGCTTCTAACCTGGAACCCGGG + Intergenic
1152528922 17:80905700-80905722 GGAGCCCTGACCTAGACCCCGGG + Intronic
1152574783 17:81135231-81135253 GGTGTCCTGATTTGGAAGCCGGG - Intronic
1152756770 17:82090294-82090316 GGGGTCCTCACCTGCAGCCCTGG - Intronic
1152911175 17:83005730-83005752 GGGGTGCTGGCCTGGATGCCCGG - Intronic
1153841932 18:9015298-9015320 GGGGTCTTGATCTGTCACCCAGG - Intergenic
1153841962 18:9015467-9015489 GGGGTCTTGATCTGTCACCCAGG - Intergenic
1154216875 18:12421963-12421985 GGGGTCTTGCCCTGTCACCCGGG + Intronic
1155883391 18:31177962-31177984 GGGGTCTTGCCCTGTCACCCAGG - Intergenic
1156236789 18:35213434-35213456 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
1156331820 18:36129991-36130013 GGAGTCCTGAACTGGAGCTCTGG + Exonic
1156744190 18:40369441-40369463 GAGGTCCTGACCCAGAGCCCAGG - Intergenic
1157290352 18:46405603-46405625 GGGATGCTGACCTGGGCCCCTGG + Intronic
1159122978 18:64191762-64191784 GTGGGCTTGCCCTGGAACCCTGG + Intergenic
1160563984 18:79775687-79775709 GGGCGCCTGTCCTGGAGCCCGGG + Intergenic
1160706162 19:531327-531349 GGGGTCCTGACCGGGACCGGAGG - Intergenic
1161969059 19:7566091-7566113 GGGCCCCTGACCCTGAACCCAGG - Intergenic
1163245731 19:16092878-16092900 GGGGTCCTGCCCTGTTGCCCAGG + Intronic
1163634171 19:18430799-18430821 GGTGTCCTGACCTGGCCCTCTGG + Intronic
1163748956 19:19064124-19064146 CGGGTCCTGTCATGGATCCCGGG + Intronic
1163838708 19:19592615-19592637 GGGGGCCTGACTTAGAACACAGG - Intronic
1164687483 19:30177292-30177314 GGGGTCCTGATCTAGACCCCAGG + Intergenic
1164692211 19:30219905-30219927 GGGGTCCTGCCCCGGATCCCAGG - Intergenic
1165318102 19:35068895-35068917 GGGGTCCTGATCCAGACCCCAGG + Intergenic
1165408347 19:35643791-35643813 GGAGTCCTGAGCCGGGACCCAGG + Intronic
1166198622 19:41222012-41222034 GGGGCCGTGACCTGGAGCCGTGG - Exonic
1167087003 19:47317165-47317187 GGGGTCTTGATCTGTCACCCAGG - Intronic
1167887057 19:52508925-52508947 GGAGTCCTGCCCTGTCACCCAGG + Intronic
1168412019 19:56146287-56146309 TGGGTCCTGCCCTGGGCCCCTGG - Exonic
925035287 2:680267-680289 GGGGTCTGCACCTGGCACCCCGG - Intergenic
925743354 2:7024934-7024956 GGAGTCCTGATCAGGAACCCCGG - Intronic
929154509 2:38777472-38777494 GGGGTCCTGATCCAGACCCCAGG - Intronic
934579772 2:95428579-95428601 TGGGTCCTGACCTCTAAACCAGG + Intergenic
934599675 2:95648146-95648168 TGGGTCCTGACCTCTAAACCAGG - Intergenic
934706490 2:96485159-96485181 GGGGTCCTGAACAGAAAGCCAGG + Intergenic
934923456 2:98365061-98365083 GGGGTCCTGCTCTGTCACCCAGG + Intronic
935862256 2:107345735-107345757 GGGGCCCTGACCTGGACCAGAGG - Intergenic
936672618 2:114675824-114675846 GGGGTCTTGCCCTGTCACCCAGG + Intronic
937259712 2:120577534-120577556 GGCATCCTTACCTGGAATCCAGG + Intergenic
938870797 2:135474163-135474185 GGGGTCCTGATCTGTCTCCCAGG - Intronic
940307639 2:152243782-152243804 TGGGTCCAGACCTTAAACCCTGG + Intergenic
943201383 2:184830068-184830090 AGGGTCTTGCCCTGGCACCCAGG - Intronic
943687195 2:190831096-190831118 TGAGTCCTGACCTGGAACACAGG + Intergenic
946158515 2:217822142-217822164 GGGGCCCTGAAATGGATCCCAGG + Intronic
946380635 2:219346372-219346394 GGGGTCCTGCTCTGTCACCCAGG + Intergenic
947554218 2:231075603-231075625 AGGGTCCTGATCTGTCACCCAGG + Intronic
948809568 2:240467705-240467727 GGGGACCTGACCAGCAACCGGGG - Exonic
948916460 2:241037003-241037025 AGACTCCTGACCTGGGACCCTGG - Intronic
948966558 2:241386116-241386138 GGGGTCTTGCTCTGTAACCCAGG + Intronic
948987821 2:241536127-241536149 GGGGGCCTGACCTGTGACCAGGG + Intergenic
948990408 2:241551131-241551153 AGGGTTCTGATCTGGAAACCAGG + Intergenic
1168968478 20:1914512-1914534 TGAGTCCCCACCTGGAACCCAGG - Intronic
1169096100 20:2900181-2900203 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1170855053 20:20044643-20044665 GGGGTCCTGCTCTGTCACCCAGG + Intronic
1171311648 20:24149786-24149808 AGGGTCCCGACCTTTAACCCAGG - Intergenic
1171797609 20:29578466-29578488 GGGGTCCTGCCCCAGATCCCAGG + Intergenic
1171850645 20:30305695-30305717 GGGGTCCTGCCCCAGATCCCAGG - Intergenic
1172275286 20:33675916-33675938 GGGGCCCTGAACTGGCCCCCTGG + Exonic
1172970291 20:38868241-38868263 GGGGTCCTGAGGTGAAACGCAGG - Intronic
1173675622 20:44832627-44832649 GTAGTCCAGACCTAGAACCCTGG + Intergenic
1174067300 20:47874924-47874946 GGGGACCTGACCTGGGCCCTGGG + Intergenic
1174156999 20:48521949-48521971 GGGGACCTGACCTGGGCCCTGGG - Intergenic
1174344598 20:49920739-49920761 AGGGTGCAGACCTGGCACCCAGG - Intergenic
1174399548 20:50268598-50268620 GGGAGCCTGCCCTGGAACACTGG - Intergenic
1175642640 20:60643711-60643733 GGATGCCTGACCTGGAAGCCTGG - Intergenic
1175714765 20:61248001-61248023 AGGAGCTTGACCTGGAACCCAGG - Intergenic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1176294618 21:5064776-5064798 GAGGTCCTGACCTGCCGCCCAGG - Intergenic
1179438266 21:41376692-41376714 GGGGCCCTGCACTGGACCCCTGG + Intronic
1179784954 21:43724270-43724292 GGCTCCCTGCCCTGGAACCCTGG + Intronic
1180837176 22:18935693-18935715 GGGCTCATAGCCTGGAACCCCGG - Intronic
1181022767 22:20112388-20112410 GGGGCCCTGACCAGGAAGACAGG - Exonic
1181142475 22:20816604-20816626 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1181513836 22:23400653-23400675 GGGGTCCACACCTGGCACCGCGG + Intergenic
1182896710 22:33864948-33864970 CTGCTCCTGACCTGGATCCCTGG + Intronic
1183506165 22:38210159-38210181 TGGGTCCTGACCTGGCACTCTGG + Intronic
1183722845 22:39572383-39572405 TGAGTCCTGCCCTGGAATCCAGG + Intronic
1184149268 22:42629003-42629025 AGAGTCCTGGCCTGGCACCCAGG - Intronic
1184205558 22:43000224-43000246 GGGGTCCTGACCTGGAACCCGGG - Intronic
1184568272 22:45306511-45306533 GGGGTCCTGAGCTGGGGCACGGG + Intergenic
1184893900 22:47396062-47396084 GGAGTCGGGAGCTGGAACCCAGG - Intergenic
1185121788 22:48975639-48975661 GGAGTCCGGGCCTGGATCCCGGG - Intergenic
1203287269 22_KI270734v1_random:160992-161014 GGGCTCATAGCCTGGAACCCCGG - Intergenic
950081998 3:10229273-10229295 GGGGTCTTGCCCTGTCACCCAGG + Intronic
950237544 3:11336692-11336714 AGGGTCTTGACCTGTCACCCAGG + Intronic
950345499 3:12288403-12288425 GGGGGGCTGTCCTGGAAGCCGGG - Intronic
952295338 3:32057321-32057343 GGGGTTCTGATCTAGATCCCAGG - Intronic
954131776 3:48564683-48564705 AGGACCCTGACCTGGAACCCTGG + Intronic
954212952 3:49108588-49108610 GGGGTGCTGGCTTGGAGCCCTGG + Intronic
954802714 3:53196376-53196398 AGGGTCTTGACCTGTCACCCAGG + Intergenic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
959811849 3:110628999-110629021 GGGGTCCTGATCCAGACCCCAGG + Intergenic
963533958 3:146504494-146504516 GGGGTCCTGATCTAGACCCCAGG + Intergenic
963895040 3:150676666-150676688 GGGGTCTTGATCTGTCACCCAGG + Intronic
966008842 3:175051349-175051371 GGTCTCCTGTCCTGAAACCCAGG + Intronic
968029143 3:195467781-195467803 GGAGTCTTGACCTGTCACCCAGG - Intergenic
968701967 4:2061588-2061610 GGGGACCTGACCTTGAGCCTTGG + Intronic
968902581 4:3438497-3438519 GGGGTCCTGCCATGGAGCTCCGG + Intronic
969539546 4:7778446-7778468 GGTCTCCTGACCTGGAGCCCAGG + Intronic
970490944 4:16573025-16573047 GGGGTTGAGAACTGGAACCCTGG - Intronic
971819271 4:31530594-31530616 GGCCTCCTGACCTGGGCCCCTGG - Intergenic
972172346 4:36361966-36361988 TGGGTCCTGACCTGCGACCTGGG - Intergenic
973989010 4:56385046-56385068 GGGGTCTTGCCCTGTCACCCAGG - Intronic
975443719 4:74439467-74439489 TGGGTCCTGACCGGGGTCCCTGG + Intergenic
978339443 4:107707005-107707027 TGGGTGCTGGCCTGGAACCTGGG + Intronic
981743717 4:148031031-148031053 GGGGTCTTGATCTGTCACCCAGG - Intronic
983861971 4:172718610-172718632 GGGGTCTTGCCCTGTCACCCAGG - Intronic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
988019745 5:25607824-25607846 GAGGTTCTGTCCTGGAACCATGG + Intergenic
988838613 5:35060473-35060495 GGGACACTGACCTGAAACCCTGG + Exonic
989617930 5:43356202-43356224 GGGGTCTTGATCTGTCACCCAGG + Intergenic
990456706 5:55995311-55995333 GGGGTCATGAACTGGAGCCCGGG + Intergenic
991773797 5:70064600-70064622 GGGGTCTTGCCCTGTCACCCAGG + Intronic
991853091 5:70940024-70940046 GGGGTCTTGCCCTGTCACCCAGG + Intronic
992943813 5:81789834-81789856 GGGGTCTTGCCCTGTCACCCAGG - Intergenic
995185751 5:109268124-109268146 GGGGAGCTGACCTGGATCCTGGG - Intergenic
995937848 5:117539101-117539123 GGGGTCTTGATCTGTCACCCAGG + Intergenic
997239801 5:132297920-132297942 GGGGTCTTGCCCTGTCACCCAGG - Intronic
997791551 5:136766780-136766802 GGGGTCCAGAGATGGAACTCAGG - Intergenic
998850860 5:146349409-146349431 GGGCTCCTAACCTGGGACCCAGG - Intergenic
999017844 5:148127830-148127852 GGGGTCCTGTTCTGTCACCCAGG - Intronic
999464037 5:151784119-151784141 GGGGTCTTGCTCTGGCACCCAGG + Intronic
999733230 5:154492141-154492163 GGGGACCTGGCCTGGAGGCCAGG + Intergenic
1003984395 6:11420237-11420259 GGGGTCCTGACTTGAAGCCTGGG - Intergenic
1005859188 6:29888239-29888261 GGGGTCGTGACCTGCGCCCCGGG - Intergenic
1005866755 6:29943041-29943063 GGGGTCCTGACCTGCGCCCCCGG - Intronic
1005931781 6:30490010-30490032 GGGGTCGTGACCTGCTCCCCTGG - Intronic
1006043188 6:31271562-31271584 GGGGTCGTGACCTGCGCCCCGGG + Intronic
1006282582 6:33067073-33067095 GTGGGCCTGACCTGCATCCCTGG - Intronic
1006729684 6:36227590-36227612 TGGTTCCTGCCTTGGAACCCAGG - Intronic
1006809653 6:36811618-36811640 GGGGACCTGGCCTAGAACTCAGG + Intronic
1007153621 6:39719955-39719977 GGGGTCCTGCTCTGTCACCCAGG - Intronic
1007175586 6:39894644-39894666 AGGGTCCTGCCCTGTCACCCAGG + Intronic
1008111547 6:47500770-47500792 GGAGTCCTGCCCTGTCACCCAGG + Intronic
1011422217 6:87185503-87185525 GAGGTCTTGCCCTGTAACCCAGG + Intronic
1013915628 6:115333942-115333964 GGGGTCTTGCTCTGTAACCCAGG + Intergenic
1016941850 6:149488860-149488882 GGGGTCCCCACCTGGACCCATGG - Intergenic
1017234318 6:152103804-152103826 GGAGTCCTGAAATGGAAACCTGG - Intronic
1018124662 6:160670051-160670073 GGAGACCTGAATTGGAACCCTGG - Intergenic
1018125521 6:160679085-160679107 GGGGTCGCGCCCTGGAACACAGG + Intergenic
1018150319 6:160931309-160931331 GGGGTCGCGCCCTGGAACACAGG - Intergenic
1018795471 6:167181907-167181929 GGGGCCCTGACCTGGAGGCCAGG + Exonic
1018820851 6:167373156-167373178 GGGGCCCTGACCTGGAGGCCAGG - Exonic
1019007196 6:168808884-168808906 GGGGTCCTGATCCAGACCCCAGG + Intergenic
1019341114 7:509480-509502 GGGGTCCTGCCATGTTACCCAGG + Intronic
1019432473 7:1005653-1005675 GGCCTCCGGGCCTGGAACCCTGG - Intronic
1020346787 7:7173879-7173901 GGAGTCTTGCTCTGGAACCCAGG - Intronic
1021606648 7:22415078-22415100 GGGTTCCTGAGCTGGACCCCAGG - Intergenic
1021675587 7:23077537-23077559 GGGGTCCTGACTTGTCACCCAGG + Intergenic
1022499052 7:30871164-30871186 GGGGGACAGACCTGGGACCCAGG + Intronic
1023018359 7:35987471-35987493 GCTGCCCTGACCTGGGACCCCGG + Intergenic
1024641132 7:51329541-51329563 GGGGTCCTGAACCAGACCCCAGG + Intergenic
1027162990 7:75815708-75815730 GAGGTCCTGACCTGGGATCCTGG - Intronic
1030687201 7:112499106-112499128 GGGGTCTTGACCTGTCACCCAGG + Intergenic
1032093073 7:128921691-128921713 GGGGTCTTGATCTGTCACCCAGG + Intergenic
1033607867 7:142940600-142940622 GGAGTTGTGACCTGGAGCCCAGG - Exonic
1034047954 7:147949754-147949776 GGTTTCCTGACCTGCAGCCCAGG - Intronic
1034959118 7:155353470-155353492 GGGGTCCTGGCCTGCAGCCCCGG - Intergenic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035181524 7:157092762-157092784 GGGGTCTTGCTCTGTAACCCAGG - Intergenic
1035734949 8:1881245-1881267 GAGGCTGTGACCTGGAACCCGGG + Intronic
1035930314 8:3773307-3773329 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1036697290 8:10984963-10984985 GGGGTCCTGCTCTGTACCCCAGG + Intronic
1037468259 8:19182176-19182198 GGAGCCATGTCCTGGAACCCTGG - Intergenic
1038686054 8:29719336-29719358 TAGGTCCTGTCCTGGCACCCTGG - Intergenic
1039885684 8:41652923-41652945 GGGGGCCTGGCCAAGAACCCTGG + Intergenic
1039900756 8:41750982-41751004 GGGGCCGTGAGCTGGAATCCCGG - Intronic
1040510004 8:48085017-48085039 GGGCTCCTCACCAGGACCCCGGG - Intergenic
1044683340 8:94803884-94803906 GGGGTCTTGATCTGTCACCCAGG + Intergenic
1045578593 8:103453277-103453299 GGGGTCATGATTTGGAATCCAGG - Intergenic
1046744093 8:117858650-117858672 GGAGTCCTGCCCTGTCACCCAGG - Intronic
1047494918 8:125402627-125402649 GGGGTCATTACCTGGGACCAAGG - Intergenic
1048526433 8:135207208-135207230 GGGATCCAGACCTAGAACCTTGG + Intergenic
1049509822 8:143021898-143021920 GTGGGCCTGACCTGGGACCAAGG - Exonic
1049549303 8:143249456-143249478 GGTGTGCAGACCCGGAACCCCGG + Intronic
1050462375 9:5887482-5887504 GGAGTACTGACCTGGATCTCAGG - Intronic
1052948469 9:34188456-34188478 GGGATCTTGCCCTGGTACCCAGG + Intronic
1053228826 9:36387288-36387310 GGGGTCCTGATCCAGACCCCAGG - Intronic
1053667595 9:40327107-40327129 GGGGTCCTGCCCTCAACCCCAGG + Intronic
1053788420 9:41668986-41669008 GGGGTCCTGCCCTGGATCCCAGG - Intergenic
1053917174 9:42952216-42952238 GGGGTCCTGCCCTCAATCCCAGG + Intergenic
1054156720 9:61645782-61645804 GGGGTCCTGCCCCAGATCCCGGG + Intergenic
1054176703 9:61880325-61880347 GGGGTCCTGCCCTGGATCCCAGG - Intergenic
1054378736 9:64467146-64467168 GGGGTCCTGCCCTCAACCCCAGG + Intergenic
1054476492 9:65576791-65576813 GGGGTCCTGCCCTGGATCCCAGG + Intergenic
1054517016 9:66049176-66049198 GGGGTCCTGCCCTCAACCCCAGG - Intergenic
1054660832 9:67700481-67700503 GGGGTCCTGCCCTGGATCCCAGG + Intergenic
1057214360 9:93219881-93219903 GGTGCCCTGCCCTGGAAGCCTGG + Intronic
1059323436 9:113487050-113487072 TGGGTGCTGACCTGGAGCCAGGG + Intronic
1059344063 9:113616399-113616421 AGTGTCCTGTGCTGGAACCCGGG + Intergenic
1060105543 9:120870516-120870538 GGGCTCCTCTCCTGGAACACCGG + Exonic
1062026518 9:134343103-134343125 GGGTTCCTGCCCTGGAGCCAGGG + Intronic
1062431879 9:136529993-136530015 GGGGCCCTGCCCTGGCTCCCAGG + Intronic
1062549559 9:137079710-137079732 GGGGACCTGCCCTGGTGCCCAGG + Intronic
1062585477 9:137247548-137247570 GGGGCCCAGAGCTGGACCCCAGG - Intronic
1062643761 9:137535725-137535747 GGGGTCTTGCCCTGTCACCCAGG - Intronic
1190040985 X:47071951-47071973 GGGGTCTTGCCCTGTCACCCAGG - Intergenic
1190152936 X:47963818-47963840 GGGGTCTTGCCCTGTCACCCAGG + Intronic
1191250366 X:58257323-58257345 GGGATCCTGGCCTGCAACCCGGG + Intergenic
1192382949 X:70636465-70636487 TGGGTGCTGGCCTGGAACCTTGG - Intronic
1196864014 X:120054378-120054400 GGGGTCCTGCTCTGTTACCCAGG + Intergenic
1196879085 X:120181952-120181974 GGGGTCCTGCTCTGTTACCCAGG - Intergenic
1199292091 X:146115948-146115970 GGGGTCTTGATCTAGATCCCAGG - Intergenic
1199607531 X:149587581-149587603 GGGGTCCTGACCTTGATGCCTGG + Intergenic
1199622433 X:149712839-149712861 GGGGTCCTGACCTTGATGCCTGG - Intronic
1199627001 X:149750419-149750441 GGGGTCCTGACCTTGATGGCTGG - Intergenic
1199628775 X:149762088-149762110 GGGGTCCTGACCTTGATGCCTGG + Intergenic
1199631592 X:149781786-149781808 GGGGTCCTGACCTTGATGCCTGG - Intergenic
1199947218 X:152679482-152679504 AGGGTCCTCACCTTGAAACCTGG - Intergenic
1199952047 X:152714917-152714939 GGGGTCCTGACCTTGATTCCTGG - Intronic
1199954686 X:152734094-152734116 GGGGTCCTGACCTTGATTCCTGG - Intronic
1199957636 X:152753531-152753553 GGGGTCCTGACCTTGATTCCTGG + Intronic
1199962462 X:152788972-152788994 AGGGTCCTCACCTTGAAACCTGG + Intergenic