ID: 1184205685

View in Genome Browser
Species Human (GRCh38)
Location 22:43001038-43001060
Sequence CTCAAATAAAACTTAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184205677_1184205685 -4 Left 1184205677 22:43001019-43001041 CCCTTGGGCCCCGTCCGACCTCA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG 0: 1
1: 0
2: 0
3: 23
4: 241
1184205678_1184205685 -5 Left 1184205678 22:43001020-43001042 CCTTGGGCCCCGTCCGACCTCAA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG 0: 1
1: 0
2: 0
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184205685 Original CRISPR CTCAAATAAAACTTAGGCCA AGG Intronic
905088862 1:35410289-35410311 TTCAATTAAAAATTAGGCAAAGG - Intronic
906894770 1:49758754-49758776 CTCAGATAAAACTTTGGCCTTGG + Intronic
907161374 1:52372491-52372513 TATAAATAAAATTTAGGCCAGGG - Intergenic
908365966 1:63424139-63424161 CTCAAAAAAAAAATAGGCAAAGG - Intronic
909411667 1:75359989-75360011 CTCAATTAAAACATAGGGAAAGG - Intronic
911275714 1:95854767-95854789 CCCAAACAAAACTTGGGCAATGG + Intergenic
911743460 1:101412872-101412894 CTCACATAAAATTAAGGCAAAGG + Intergenic
914794479 1:150908588-150908610 CTCAATTAAAAATTAGGCAAAGG - Intergenic
915184956 1:154097911-154097933 CCCAAACAAAACTTGGGCAAAGG - Intronic
917681834 1:177375494-177375516 CCAACATAGAACTTAGGCCATGG - Intergenic
918648245 1:186926932-186926954 CTAATTTAAAAATTAGGCCATGG - Intronic
919044309 1:192431382-192431404 CTCAAATAAGACTTTGGACTTGG + Intergenic
920325076 1:205156662-205156684 CTCAGATAAAACTTTGGACTTGG + Intronic
921815267 1:219556445-219556467 ATGAAATTAAACTTAGGTCACGG - Intergenic
922370933 1:224910016-224910038 CTCATATAAAACTTTGGACTTGG - Intronic
923137551 1:231131702-231131724 CTCAATTCCAACTTAGGCAATGG + Intergenic
924385174 1:243493127-243493149 CTCAAACAAAAGACAGGCCAGGG - Intronic
1062830887 10:604935-604957 CTCTGATAAAACTCAGCCCAAGG + Intronic
1063238176 10:4141118-4141140 CGCAAATAAACCTTACCCCAGGG - Intergenic
1065013676 10:21442178-21442200 CAAAAATAAAATTTAGGCCAGGG + Intergenic
1073809867 10:107141242-107141264 CCAAGATAAAACTTAGCCCAGGG - Intronic
1074031108 10:109689273-109689295 CCCAATTAAAAAATAGGCCAAGG - Intergenic
1074247796 10:111712795-111712817 CCCAAACAAAACTCAGGCAAAGG - Intergenic
1074844139 10:117382056-117382078 CTCAAAAAAAAAATAGGCAAAGG - Intergenic
1075736605 10:124668278-124668300 CTCAGAAACAGCTTAGGCCAAGG - Intronic
1075860147 10:125668030-125668052 CAGAAATAAATCTTTGGCCAGGG + Intronic
1078697190 11:13646236-13646258 TTCAAAGAAAACTGAAGCCATGG - Intergenic
1078989963 11:16636492-16636514 CTCAAATAAGACTTTGGACTTGG + Intronic
1079710342 11:23675650-23675672 CCCAAATAAAAAGTGGGCCAAGG + Intergenic
1082850865 11:57763536-57763558 TTCAAATACAACCTAGGCAAAGG + Intronic
1083134661 11:60661060-60661082 ACCAAATAAAACTTAAGACAAGG + Intergenic
1085729600 11:78985217-78985239 ATCAAATAATACATAGGACATGG - Intronic
1086280209 11:85176776-85176798 CTCAATTAAAAAGTAGGCAAAGG + Intronic
1087390128 11:97520945-97520967 CACACAAAAACCTTAGGCCACGG - Intergenic
1090602196 11:128384757-128384779 CTCAAAAAAAATATAGGCTAGGG + Intergenic
1092403410 12:8197260-8197282 CTCAAATAAGACTTTGGACTTGG - Intergenic
1092840633 12:12537613-12537635 CTCATCTAAAACATAGTCCACGG + Intronic
1093492850 12:19725126-19725148 CTCAAGCAAAACTCAGGCAAAGG - Intergenic
1094051534 12:26226349-26226371 CTCTAACAAAGCTTAGGCCAGGG - Intronic
1095139231 12:38641361-38641383 CTAAAATACAAATTAGGCTAAGG + Intergenic
1096569473 12:52513204-52513226 CTCAAATAATACTTATACCTGGG + Intergenic
1099586846 12:84529303-84529325 CTCTAAGAAAATTTAAGCCATGG - Intergenic
1099902729 12:88732687-88732709 AAAAAATAAAACTTAGGACAAGG - Intergenic
1099911352 12:88838358-88838380 CTCAGATAAAACTTTGGACTTGG - Intergenic
1100172987 12:91998470-91998492 CTCAAAAAAAACTGATGCAAAGG + Intronic
1104003033 12:124872583-124872605 CTCAAAAAAAAGTAAGGCCAGGG - Intronic
1106586348 13:31059586-31059608 CTCAAATAATATTTAGTCAATGG - Intergenic
1107606328 13:42060961-42060983 CTCCAGGAAAACTTAGGACATGG + Intronic
1108872305 13:55002330-55002352 CTCAAATAAAGGGTAGGTCAGGG + Intergenic
1109115844 13:58383063-58383085 CTCAATAAGAACTTAGGCAATGG - Intergenic
1109148369 13:58811942-58811964 CTCAAATAAAAAGTTGGCAAAGG - Intergenic
1110208534 13:72946543-72946565 CTCAGATAAGACTTTGGCCTTGG - Intronic
1110475826 13:75912135-75912157 CTCAAAAAAAACTTCTGCCTTGG + Intergenic
1110756552 13:79181778-79181800 CTCTCATAAAACATAGGGCAGGG + Intergenic
1112805308 13:103158456-103158478 CTCAAAAAAAACTGAAGCAATGG - Intergenic
1116632164 14:47349983-47350005 CTGAAATGAAGCTTAAGCCAGGG - Intronic
1118268030 14:64314259-64314281 CCTAAATAAAACATAGGTCAAGG + Intronic
1118506615 14:66420383-66420405 TTCAAATTAGATTTAGGCCAAGG - Intergenic
1118816845 14:69319945-69319967 CTCATATAATGCCTAGGCCAGGG + Intronic
1119753104 14:77094700-77094722 TTCAAATAAAACTCGGCCCATGG + Intergenic
1120014091 14:79450562-79450584 GTCAATTAAAAATAAGGCCAGGG + Intronic
1120627716 14:86849612-86849634 CTAAAATAAAACCTATGTCAGGG + Intergenic
1121359076 14:93239416-93239438 ATAAAATAAAATTTAGGCCATGG - Exonic
1121746555 14:96299480-96299502 CTAATATAAAACTTGGGACAAGG + Intronic
1125113918 15:36066871-36066893 CCCAAACAAAACTCAGGCAAAGG - Intergenic
1125425353 15:39543185-39543207 CTAAAATAGAACTTAGGAGATGG + Intergenic
1125592388 15:40862938-40862960 CTTAAATATATCTGAGGCCAGGG - Intergenic
1125898488 15:43323399-43323421 TTCACATAAAAATTAGGGCAAGG + Intergenic
1128791232 15:70435407-70435429 CTCAATGAAGACTGAGGCCAGGG + Intergenic
1128807667 15:70544208-70544230 CTCAATTAAAAATTGGGCAAAGG + Intergenic
1128849752 15:70942116-70942138 CTAAAATTAAACTAAGGCCTGGG + Intronic
1133131130 16:3676599-3676621 CTCAGAGTAAACTTAGGCCAAGG - Intronic
1133656243 16:7867404-7867426 TTCAAATAATACTTAGGTGATGG - Intergenic
1135876184 16:26202369-26202391 CTCAAATAGCACTTAGGCCTTGG + Intergenic
1137814300 16:51383702-51383724 CCCAAACAAAACTTGGGCCCAGG - Intergenic
1139924354 16:70478042-70478064 CTAAAACAAAACTCAGGCCTTGG + Intronic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1140422669 16:74833496-74833518 CTCACACAAAACTGAGGCCCTGG + Intergenic
1141325951 16:83059520-83059542 CTCATAAGAAACCTAGGCCATGG - Intronic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1144299269 17:13908243-13908265 CCCAATTAAAAATTAGGCAAAGG + Intergenic
1145285440 17:21502780-21502802 CTTAAATAATACCTAGCCCAAGG - Intergenic
1145392085 17:22462964-22462986 CTTAAATAATACCTAGCCCAAGG + Intergenic
1150125438 17:62631907-62631929 CTCAAATAAAGAATAGGCCATGG - Intronic
1151625911 17:75275657-75275679 ATAAAATACAACTTAGGCCCAGG + Intronic
1152914305 17:83025093-83025115 CTCAAATAAAACAGAAACCATGG + Intronic
1155754471 18:29473287-29473309 CTAGAAGAAAACTTAGGCAATGG - Intergenic
1156398803 18:36722559-36722581 TTTAAATAAAAATTAGGTCAGGG + Intronic
1156966284 18:43097647-43097669 CTCAAGTAAAACTCAGCCAATGG - Intronic
1157077359 18:44480076-44480098 CTCAGATAAAACTTTGGACTTGG + Intergenic
1158340190 18:56457909-56457931 CTGAAATAAAAGTTAAGTCAGGG - Intergenic
1158813812 18:61070696-61070718 CTGAAATAATACTAAGGCCAAGG + Intergenic
1161145242 19:2673967-2673989 CTAAAAGAAATCTGAGGCCAGGG + Intronic
1162981986 19:14246436-14246458 CTCAAAAAAAAAAAAGGCCAGGG + Intergenic
1164496241 19:28765407-28765429 TTCACATTAAACTTAGGCCTTGG - Intergenic
1164988536 19:32667465-32667487 TTAAAATAAATTTTAGGCCAAGG - Intronic
1166370565 19:42298194-42298216 CTCAAAAAATAAATAGGCCAAGG + Intronic
1166907087 19:46118902-46118924 GTCAACTCAAACTGAGGCCAAGG - Intergenic
925313976 2:2907283-2907305 CTCAAATAAAACTCACACAACGG - Intergenic
928149808 2:28816531-28816553 GTCAAATAAAACTCATGCCATGG - Intronic
928282440 2:29960607-29960629 CACAATTAAAACATAGGCAAAGG + Intergenic
929427609 2:41859497-41859519 GTGAAATAAAACTTAGATCATGG + Intergenic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
930372896 2:50526668-50526690 CCCAAATAAAACAGAGGCAAAGG + Intronic
931083061 2:58797388-58797410 CTTAAATAATAATTAGGTCAAGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934700055 2:96431626-96431648 CCCAAACAAAACTCAGGCAAAGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937542497 2:122975516-122975538 GACAAATAAAACTTTGGCCTTGG - Intergenic
937583333 2:123515715-123515737 CTCAAATAAAAGTGTTGCCAGGG - Intergenic
938242304 2:129752852-129752874 CTCAAAGAAAACTTTGGCTGAGG + Intergenic
940548573 2:155121740-155121762 CTAAAGTAAAACTTAGGCAATGG + Intergenic
942044775 2:172094205-172094227 CTCAAATAGAGCATTGGCCAGGG + Intergenic
942499289 2:176571409-176571431 GTCAAATGAAACATATGCCATGG - Intergenic
943395640 2:187329355-187329377 CTCAAATGAGACTTTGGACATGG + Intergenic
947132500 2:226943516-226943538 CTAAAATAAAATGTAGCCCATGG + Intronic
1173884401 20:46445043-46445065 CCCAAACAAAACTTGGGCAAAGG - Intergenic
1174122177 20:48274274-48274296 TTCAAATAAAACTTTAGCAAGGG + Intergenic
1174786617 20:53438658-53438680 CCCAAATAAAAATTAGGGCTGGG + Intronic
1175016761 20:55799924-55799946 CTCAACTAAAACTTATCCCTGGG - Intergenic
1175908010 20:62391372-62391394 CTCAAAGTACACGTAGGCCATGG + Exonic
1177527841 21:22319654-22319676 CCTAAATAAAACTTGGGCAAAGG + Intergenic
1178510947 21:33204503-33204525 CTCAACTAAGACTTAAGACAAGG + Intergenic
1179228955 21:39483097-39483119 CTCAAATAAAACTTGTTTCAAGG + Intronic
1179427502 21:41293551-41293573 ATCATATAAAACATGGGCCAAGG - Intergenic
1184205685 22:43001038-43001060 CTCAAATAAAACTTAGGCCAAGG + Intronic
1184527677 22:45035181-45035203 CTCAAAGACATCTTTGGCCAAGG + Intergenic
1184868779 22:47219915-47219937 CTCAGATCACACTGAGGCCAGGG + Intergenic
952041527 3:29267480-29267502 CCCAAATTGAAATTAGGCCAGGG + Intergenic
952221292 3:31326739-31326761 CTCAGATGAAACTTTGGACATGG - Intergenic
953063109 3:39444099-39444121 TTCACATAAGACTTAGTCCATGG + Intergenic
954737221 3:52716238-52716260 CCCAAGTAAAACTCAGGCAAAGG + Intronic
956786343 3:72645674-72645696 TTTAAATAAAGCTTAGGCCAGGG - Intergenic
959319861 3:104858575-104858597 TTCTAATATCACTTAGGCCAAGG - Intergenic
959924282 3:111904275-111904297 CTCAAAAAAAAAAAAGGCCAAGG + Intronic
961177940 3:124851337-124851359 CACAAAGAAAACTTTGGCCTCGG + Intronic
961368713 3:126416828-126416850 CTGTAATAAAAGTTAGGCAAAGG - Intronic
963687270 3:148452388-148452410 GTCAAATAAAAATTTGTCCAAGG + Intergenic
963993342 3:151678941-151678963 CTCAAGTAAACCTCAGGCCTCGG + Intergenic
966172446 3:177097463-177097485 CTCTTATAAAACTTAGGTGATGG - Intronic
966473158 3:180315128-180315150 AGCAAATGAAACTTAGGCAATGG + Intergenic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
966706223 3:182917968-182917990 CTCAATTAAAACATAGGTCCTGG + Intronic
967678549 3:192331029-192331051 CTCAATTAAAAAGTAGGCAAAGG + Intronic
967702762 3:192612864-192612886 CTCAAAGAAAAATTTGGGCAAGG - Intronic
969762658 4:9200600-9200622 CTCAAATAAGACTTTGGACTTGG + Intergenic
969960594 4:10940863-10940885 CTCAAATGAAACTTTGGCCTTGG + Intergenic
970180458 4:13386425-13386447 CTCAATTAAAAAGTGGGCCAAGG + Intronic
970969778 4:21968627-21968649 CTCCATTAAAACATAGGCAAAGG + Intergenic
971156092 4:24084531-24084553 AACAAATGACACTTAGGCCAAGG - Intergenic
972285738 4:37646192-37646214 CTCAAATATCACTGAGGGCATGG + Intronic
972292450 4:37702416-37702438 TTCAATCAAAACTTAAGCCAGGG + Intergenic
972562475 4:40240859-40240881 GTCAAATAAAACTTAAGGCCAGG + Intronic
973861199 4:55066669-55066691 CTCAATTAAAAGTTAGTCCCAGG - Intergenic
974017404 4:56660617-56660639 ATCAAATAAAACTTTGAGCAAGG - Intronic
974057733 4:57001168-57001190 CTCCAAAAAAAATAAGGCCAAGG - Intronic
974743719 4:66042321-66042343 CTCAAACAAAAAATGGGCCATGG + Intergenic
974872589 4:67661133-67661155 CTCAGATAAGACTTTGGACATGG + Intronic
974972257 4:68844881-68844903 CTAAATTAAAGCTCAGGCCATGG + Intergenic
975538575 4:75478342-75478364 CTCAATTAAAACATGGGCAAAGG + Intergenic
975992858 4:80278676-80278698 CTCAAATAAAACTTATCTGATGG - Intronic
976442366 4:85089767-85089789 CTCAGATAAGACTTTGGACATGG + Intergenic
976636080 4:87287443-87287465 CTCAGATAAAACTTTGGACTTGG + Intergenic
976726836 4:88223165-88223187 CTCAGATAAGACTTAGGACTTGG + Intronic
977021674 4:91768074-91768096 CTCAAAGGAAAAATAGGCCAAGG - Intergenic
977078411 4:92489299-92489321 CTTAAATAACATTTAGGACATGG - Intronic
978095466 4:104770657-104770679 TTAGAATAAAACATAGGCCAAGG - Intergenic
978229752 4:106384913-106384935 CTCAAGCAAAACTTGGGCAAAGG - Intergenic
978612744 4:110562078-110562100 CTCAAGTAAAACTTAAGCCCAGG - Exonic
979478979 4:121192433-121192455 CTCAAACAAAACTCATGCAAAGG - Intronic
981993974 4:150956398-150956420 CAAAAAAAAAACTTAGGCCCAGG + Intronic
982583918 4:157212921-157212943 CTCAATTAAAAAATAGGCTATGG - Intronic
982681024 4:158430829-158430851 CTCAAATAAAAAATGGGCAAAGG + Intronic
982797429 4:159663200-159663222 CTCAGATAAAATTTTGGACATGG - Intergenic
982802452 4:159722105-159722127 CTCAAGCAAAACTCAGGCAAAGG - Intergenic
983534982 4:168848050-168848072 CTCTAAGAAAACTGAGCCCAGGG + Intronic
985053776 4:186018314-186018336 GTCAAATAACACTTGGGCAATGG + Intergenic
987697728 5:21354405-21354427 CTCAGATGAAACTTTGGACATGG - Intergenic
987957764 5:24763093-24763115 GTCAACTAAAACTCAGCCCAAGG + Intergenic
988583338 5:32487763-32487785 CTAGAATATAACTGAGGCCAGGG - Intergenic
988754509 5:34232289-34232311 CTCAGATGAAACTTTGGACATGG + Intergenic
989352991 5:40509048-40509070 CTCAAAGAAAACTTTGACAATGG - Intergenic
991742717 5:69697983-69698005 CTCAGATGAAACTTTGGACATGG + Intergenic
991754977 5:69857221-69857243 CTCAGATGAAACTTTGGACATGG - Intergenic
991794290 5:70277721-70277743 CTCAGATGAAACTTTGGACATGG + Intergenic
991822106 5:70573296-70573318 CTCAGATGAAACTTTGGACATGG + Intergenic
991834304 5:70732369-70732391 CTCAGATGAAACTTTGGACATGG - Intergenic
991886669 5:71277263-71277285 CTCAGATGAAACTTTGGACATGG + Intergenic
995386769 5:111597042-111597064 CCCAAGCAAAACTTAGGCAAAGG + Intergenic
995430215 5:112066541-112066563 CTCATGTAAAAGTTAGGTCAGGG + Intergenic
998792393 5:145778828-145778850 CCCAAGTAAAACTCAGGCAAAGG + Intronic
998956058 5:147439526-147439548 CTCAACTAAAACCCAGACCATGG - Intronic
1000190367 5:158904445-158904467 CCCAAATAAAACAAAGGTCATGG - Intronic
1000313455 5:160066576-160066598 CTGAAATAAAAGTTTGGGCACGG - Intronic
1000524017 5:162332615-162332637 CTCAAAAAAAACCTAGGTGATGG + Intergenic
1000915749 5:167079144-167079166 TTCAAATAAATTTTAGTCCATGG + Intergenic
1002656301 5:180750938-180750960 CTCAAATAAAAAATTAGCCAGGG + Intergenic
1003428469 6:6016143-6016165 CTCAATTTAAACATAGGCAAAGG - Intergenic
1005706302 6:28457236-28457258 CCCAACTAAAACATGGGCCAAGG + Intergenic
1010519859 6:76818821-76818843 CCCAAGTAAAACTTGGGCAAAGG + Intergenic
1010783764 6:79975850-79975872 GCCAAATAAAATTTTGGCCAGGG + Intergenic
1011502228 6:88003404-88003426 CTCATATAAAAATAAGACCATGG + Intergenic
1013981272 6:116132628-116132650 CTCAGTTAAACATTAGGCCAGGG - Intronic
1015459875 6:133477437-133477459 CTCAAATAAAAAATGGGCAATGG - Intronic
1015564762 6:134557640-134557662 CTCCAATAAAACCAAGGGCAAGG - Intergenic
1015887713 6:137935838-137935860 CCCAATTAAAACATAGGCAAAGG - Intergenic
1017794023 6:157824834-157824856 TAAAAATAAAACTTAGGCCAAGG + Intronic
1019816611 7:3205704-3205726 TTTAAGAAAAACTTAGGCCAGGG - Intergenic
1020376895 7:7497711-7497733 CTAAAATAAAATATAAGCCAAGG + Intronic
1022788896 7:33666828-33666850 CTCAATTAAAACATAGGCAAAGG - Intergenic
1023497625 7:40815327-40815349 CACATAGAGAACTTAGGCCAAGG - Intronic
1023839167 7:44086225-44086247 TCCAAATAATACTTAGGCCCAGG + Intergenic
1024723792 7:52169349-52169371 CCCAGAGAAAACTTAGGTCATGG + Intergenic
1027575331 7:79923279-79923301 CTCAAGCAAAACTCAGGCAATGG + Intergenic
1028052950 7:86207813-86207835 CTCAAACAAAACTCAGGCAAAGG - Intergenic
1028640930 7:93040690-93040712 CCCAAGCAAAACTTAGGCAAAGG + Intergenic
1029329102 7:99836540-99836562 CTCAAATAACACTTACCCTAAGG - Exonic
1030047037 7:105506755-105506777 CTCATATAAAACTTGAGCCAAGG - Intronic
1030302116 7:107984768-107984790 CTCAAATATCACATAGGACATGG + Intronic
1030423468 7:109339727-109339749 CTGAAACAAAACCTAGGACAAGG + Intergenic
1031241736 7:119252817-119252839 CTCAAATAAATCTTGGAGCATGG - Intergenic
1031567566 7:123319839-123319861 GTCAAGTAAAACCTAGCCCAGGG - Intergenic
1032377651 7:131438712-131438734 ATCAAAAAAAACTTTGGACATGG - Intronic
1032573376 7:133025802-133025824 TTGAAATAAAACTTAGGTCCTGG - Intronic
1033256280 7:139804426-139804448 CTCAGATGAAACTTAGGACTTGG + Intronic
1034377516 7:150659180-150659202 CACAAAGGAAACTGAGGCCACGG - Intergenic
1034689197 7:153000408-153000430 CTCAGATAAGACTTTGGCCTTGG - Intergenic
1036065407 8:5375519-5375541 CTCAACGAAAAGTTAAGCCATGG + Intergenic
1036272752 8:7322335-7322357 CTCAAATAAGACTTTGGACTTGG + Intergenic
1036348596 8:7988013-7988035 CTCAAATAAGACTTTGGACTTGG - Intergenic
1036843868 8:12148481-12148503 CTCAAATAAGACTTTGGACTTGG - Intergenic
1036865237 8:12390802-12390824 CTCAAATAAGACTTTGGACTTGG - Intergenic
1037592660 8:20326230-20326252 CTCAATTAAAAAGTAGGCAAAGG + Intergenic
1038926118 8:32141436-32141458 CTGAAATGAAATTTTGGCCAGGG + Intronic
1039102085 8:33951624-33951646 ATCAACTCAAACTTAGCCCAAGG + Intergenic
1041872855 8:62654865-62654887 CTCAAATAAGAGAGAGGCCATGG + Intronic
1043072134 8:75651507-75651529 CTCAAAAAAAAATAAGGCAATGG + Intergenic
1043266187 8:78270320-78270342 CTCAGATAAAACTTTGGACTTGG - Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1046569896 8:115949865-115949887 CTCAAATAAAAATTGGCCCCAGG - Intergenic
1047500068 8:125433417-125433439 CTCAAAGAAGACATAGGCCTTGG - Exonic
1047783707 8:128133235-128133257 TTCAAACAGAACTTAGACCAAGG + Intergenic
1048547217 8:135398422-135398444 CAGAAAAAAAACTTAGCCCAAGG + Intergenic
1048607872 8:135988768-135988790 ATAAAATAAAATGTAGGCCATGG + Intergenic
1050213088 9:3286996-3287018 CTAAAATAAAACTTTGATCAAGG - Intronic
1054855285 9:69892812-69892834 CTCAAAGAAGACTTCAGCCAGGG + Intronic
1058564066 9:106261725-106261747 TTCAAATAATACTTAGGTCAAGG - Intergenic
1059954400 9:119500626-119500648 CTAAAATAAAAATTGGGTCATGG + Intronic
1188302578 X:28523878-28523900 CTCAACAAAAAGTTAGACCAGGG + Intergenic
1188459904 X:30412473-30412495 TTGAAATAAAATTAAGGCCACGG - Intergenic
1188634971 X:32418269-32418291 CTCAAATAAAGCAAAGGCAAAGG + Intronic
1189816370 X:44828455-44828477 CTAAGGTAAAACATAGGCCATGG - Intergenic
1190163373 X:48050731-48050753 CTGTAATAAAACCTAGGCCAAGG + Intronic
1193056076 X:77152611-77152633 CCCCAACAAAACTTGGGCCAAGG + Intergenic
1193864972 X:86720281-86720303 CTCAGATAAAACTTCGGACTTGG - Intronic
1194123095 X:89984508-89984530 CTCAATTAAAATTTGGGCAAAGG - Intergenic
1194435164 X:93860589-93860611 CTCAAATGAAACTTTGGACTTGG + Intergenic
1194843712 X:98776692-98776714 CTCAAATGAAACTTTGGACTTGG + Intergenic
1195127650 X:101823568-101823590 CCCAAGCAAAACTTAGGCAAGGG + Intergenic
1197569597 X:128132367-128132389 CTCAAATGAAACTTTGGACTTGG + Intergenic
1197841453 X:130751886-130751908 CTCAATCAAAACATAGGCTAAGG - Intronic
1200257488 X:154591984-154592006 CTCAATTAAAACACAGGACAAGG - Intergenic
1200475953 Y:3641954-3641976 CTCAATTAAAATTTGGGCAAAGG - Intergenic
1202348093 Y:23956434-23956456 CTGAAATAAAACATAGCCCTAGG - Intergenic
1202522681 Y:25713670-25713692 CTGAAATAAAACATAGCCCTAGG + Intergenic