ID: 1184206225

View in Genome Browser
Species Human (GRCh38)
Location 22:43005437-43005459
Sequence TTGGCACCTGGCCCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184206225_1184206232 2 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206232 22:43005462-43005484 GCAGCTTACAAAAGGTGGTGGGG No data
1184206225_1184206227 -6 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206227 22:43005454-43005476 TGCCAACAGCAGCTTACAAAAGG No data
1184206225_1184206231 1 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206231 22:43005461-43005483 AGCAGCTTACAAAAGGTGGTGGG No data
1184206225_1184206230 0 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206230 22:43005460-43005482 CAGCAGCTTACAAAAGGTGGTGG No data
1184206225_1184206234 29 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206234 22:43005489-43005511 AGACAGGCCCTGTAAGTGCCAGG No data
1184206225_1184206229 -3 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206229 22:43005457-43005479 CAACAGCAGCTTACAAAAGGTGG No data
1184206225_1184206233 13 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA No data
Right 1184206233 22:43005473-43005495 AAGGTGGTGGGGAGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184206225 Original CRISPR TTGGCACCTGGCCCTTTTGT TGG (reversed) Intronic