ID: 1184206225

View in Genome Browser
Species Human (GRCh38)
Location 22:43005437-43005459
Sequence TTGGCACCTGGCCCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184206225_1184206230 0 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206230 22:43005460-43005482 CAGCAGCTTACAAAAGGTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 181
1184206225_1184206231 1 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206231 22:43005461-43005483 AGCAGCTTACAAAAGGTGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 219
1184206225_1184206233 13 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206233 22:43005473-43005495 AAGGTGGTGGGGAGAAAGACAGG 0: 1
1: 1
2: 5
3: 59
4: 621
1184206225_1184206234 29 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206234 22:43005489-43005511 AGACAGGCCCTGTAAGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1184206225_1184206229 -3 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206229 22:43005457-43005479 CAACAGCAGCTTACAAAAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 150
1184206225_1184206232 2 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206232 22:43005462-43005484 GCAGCTTACAAAAGGTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 154
1184206225_1184206227 -6 Left 1184206225 22:43005437-43005459 CCAACAAAAGGGCCAGGTGCCAA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1184206227 22:43005454-43005476 TGCCAACAGCAGCTTACAAAAGG 0: 1
1: 0
2: 2
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184206225 Original CRISPR TTGGCACCTGGCCCTTTTGT TGG (reversed) Intronic
901007325 1:6178411-6178433 TTGGGGTGTGGCCCTTTTGTGGG - Intronic
902196817 1:14804167-14804189 TTGGCTCCTGGCAATTCTGTTGG + Intronic
902732826 1:18380888-18380910 CTGGCACCTGGAGTTTTTGTAGG - Intergenic
903326253 1:22570576-22570598 TTTTCATCTGGGCCTTTTGTGGG + Intronic
907304392 1:53505721-53505743 TTGGCACCTGGCCTGTCTGCAGG + Intergenic
907429246 1:54402389-54402411 TTGGCACTTGAACCTTTTTTAGG - Intronic
907490667 1:54806937-54806959 CTGGCACCTGGCCCTGGCGTGGG - Intronic
910874869 1:91869011-91869033 TGAGGACTTGGCCCTTTTGTGGG - Intronic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
916145529 1:161735744-161735766 GTGGCTCCTGGATCTTTTGTAGG - Intergenic
922304326 1:224330667-224330689 TTTTCACCTAGCCCTTTTGTCGG - Intergenic
922608422 1:226905945-226905967 ATGGCACCATGTCCTTTTGTGGG - Intronic
1063204005 10:3813310-3813332 TTGTCACATGGCCGTTGTGTAGG + Intergenic
1063939656 10:11114186-11114208 TGAGCACCTGGCCCTTTGCTAGG - Intronic
1064285786 10:13990296-13990318 TTTGCTCCTGGCCATTTTCTTGG + Intronic
1068704437 10:60057857-60057879 TTTGCAACTGTCTCTTTTGTAGG + Intronic
1072448086 10:95516843-95516865 TTGGCGCATGGCCTGTTTGTCGG - Intronic
1073229748 10:101959100-101959122 TAGGCAGCTGGCCCTTTTAATGG + Intronic
1075123215 10:119679647-119679669 GTGGCCCCTGGGCCTTGTGTGGG + Intergenic
1075502780 10:122992266-122992288 TTGGCACTTGGGGGTTTTGTGGG + Exonic
1077629056 11:3798254-3798276 TTTGTACCAGGCCCTTTGGTGGG - Intronic
1077725758 11:4673279-4673301 TTGGAAACTGGCCTTTCTGTTGG + Intergenic
1078183374 11:9030727-9030749 TTGGCAGCTTGCCTTTTTCTAGG - Intronic
1079033062 11:16999961-16999983 TTTGCATCTGGTTCTTTTGTGGG - Intronic
1079450596 11:20597398-20597420 TTCGCACCTGGCCCTTTGCGGGG + Intergenic
1080373715 11:31682906-31682928 TTGACACCTTGCCCATTTGACGG + Intronic
1082771401 11:57210643-57210665 TTCCCACCTGGCCCCTTTCTTGG + Intergenic
1089399389 11:118155789-118155811 TTGGCTCCTGTCCCTTCTGCTGG + Intergenic
1091175337 11:133552881-133552903 TTGGGAAGTGGCCCTTTTCTTGG - Intergenic
1092257212 12:6933858-6933880 TGGGCACCTGGAACTTTTGCAGG - Exonic
1096585164 12:52615174-52615196 TTGGCTCCAGGCCCTTCTGCGGG + Intronic
1098175057 12:67781512-67781534 TTGGCACCAGGCACTGTTCTAGG - Intergenic
1099011171 12:77293001-77293023 TTACCAGCTTGCCCTTTTGTTGG + Intergenic
1100876694 12:98969281-98969303 ATGGCACCTGGCCCTCTTCCTGG - Intronic
1103467857 12:121156262-121156284 TGAGCACCTGCCTCTTTTGTGGG + Intronic
1103853192 12:123946650-123946672 CTGGCACCAGGCCCATTCGTGGG - Intronic
1103879403 12:124154489-124154511 ATGGCAGCTGGCCCTTTAGCTGG + Intronic
1106419306 13:29572358-29572380 CTGGCACCTGCCCCTTTAGGTGG - Intronic
1107771777 13:43794476-43794498 TTGGCCTCTGGCCATTCTGTGGG + Intergenic
1108517912 13:51220468-51220490 ATTGCACCTGGCCCATTTTTTGG - Intergenic
1109746192 13:66625951-66625973 ATGGCACCTGGCCTATATGTTGG + Intronic
1115738695 14:36364006-36364028 TAGGCTCCTGGCCCTCTTGGAGG + Intergenic
1127540882 15:59937792-59937814 ATTGCACCTGGCCCTTTTGCAGG - Intergenic
1132996893 16:2828098-2828120 TTGACACCTGGCCCTTCTTCTGG - Intergenic
1133462002 16:5994824-5994846 TGGGCACTTGGCCCTTTGCTAGG - Intergenic
1137334963 16:47539190-47539212 CTGACTCCTGGCCCTTTGGTTGG + Intronic
1138019535 16:53465755-53465777 TTGGCACCTTCCCAATTTGTGGG - Intronic
1138175507 16:54894427-54894449 GTGGCATCTGGCCCATTAGTGGG + Intergenic
1138565207 16:57828086-57828108 GTGGCCCCTGGCCCTCTTGGAGG + Intronic
1140104131 16:71943731-71943753 TTGGCAGATGGCTCTTCTGTAGG - Intronic
1140902871 16:79385969-79385991 TAGGCACCTGGCACTTTCTTAGG + Intergenic
1143564215 17:7711884-7711906 TGGGCACCTGGGCTTTTTGGGGG - Intergenic
1144507968 17:15849499-15849521 TGTGCACCTGACCCTTTTGTAGG + Intergenic
1144588716 17:16505501-16505523 TTCTCACATGGCCCTTTTGGTGG - Intergenic
1145119675 17:20246458-20246480 TCTGCACCTGGCCCTCTTGGAGG + Intronic
1145172092 17:20667131-20667153 TGTGCACCTGACCCTTTTGTAGG + Intergenic
1145202301 17:20957217-20957239 TGTGCACCTGGCCCTCTTGTAGG + Intergenic
1148042121 17:44716236-44716258 CTGGGACCTGGCAATTTTGTGGG + Intronic
1148155355 17:45421654-45421676 TTGGCAGCTGTCCCTTCTCTGGG - Intronic
1149428655 17:56579036-56579058 TTAGCACCTGGCCCTTCAATAGG - Intergenic
1150387039 17:64770304-64770326 TTGGCAGCTGTCCCTTCTCTGGG - Intergenic
1150880104 17:69014909-69014931 TTGGCCCCAGACCCTTCTGTAGG - Intronic
1151694571 17:75707585-75707607 ATGGCACCTGGTACTCTTGTGGG + Exonic
1151882894 17:76905498-76905520 GTGGCCCCTGGCCCTTTTCAAGG + Intronic
1152126574 17:78450768-78450790 TTCGCTCCTGGCCCGTCTGTCGG - Exonic
1152375212 17:79915370-79915392 TTGCCACCTGGTCGTTTTGCTGG - Intergenic
1155037891 18:22040697-22040719 TTGGCACCAGGTCCCTGTGTTGG + Intergenic
1156415549 18:36885277-36885299 TTGGCACCTGCATCCTTTGTAGG + Intronic
1158152651 18:54389967-54389989 TTGGCTCCTGGCACTGTTCTAGG + Intergenic
1160449304 18:78951416-78951438 GAGGCACCAGGACCTTTTGTTGG - Intergenic
1161848750 19:6727710-6727732 TTGGCTCGTGGCCCCTTTCTTGG + Intronic
1165109623 19:33494089-33494111 TTGGCACATGGCACTTTGCTGGG - Intronic
1165968677 19:39606363-39606385 GTGGAACTTGGCCCTTTTGGGGG + Intronic
1168597399 19:57689245-57689267 ATGGCACCTGGCTCCTTTGCAGG - Exonic
927813199 2:26191839-26191861 TCGGCACCAGGCCCTGTTCTAGG - Intronic
929470225 2:42184394-42184416 TTAGCACCGGGGCCTGTTGTGGG - Intronic
929882224 2:45847026-45847048 TTGGTACCTGGCTCTGTTCTTGG - Intronic
937115967 2:119405183-119405205 ATGGCACCTGGCTCTTCTTTAGG - Intergenic
941621319 2:167782394-167782416 TTGACTCCTGGCCCCTTTGCTGG - Intergenic
944310200 2:198224694-198224716 CTGGCACATAGCCCTTCTGTAGG + Intronic
946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG + Intronic
946197169 2:218040638-218040660 TTTATACCTTGCCCTTTTGTGGG + Intronic
946213616 2:218166702-218166724 TTTATACCTTGCCCTTTTGTGGG - Intronic
946407581 2:219500005-219500027 CTGGCACCTCACCCTTTTGAGGG - Exonic
946804000 2:223451778-223451800 TCCGCACCTGGCCCCTATGTGGG + Intergenic
947841458 2:233210435-233210457 TCGGCGCCTGGCCCTGCTGTAGG + Intronic
948151278 2:235747002-235747024 TTGACACCTGGGACTTTGGTGGG + Intronic
948250413 2:236523956-236523978 TGGGCTGCTGGCCCGTTTGTTGG + Intergenic
1168731020 20:80650-80672 ATGGCACCAGGGCCTGTTGTGGG - Intergenic
1173810757 20:45953758-45953780 CTGGCACCTGGTCCATTTGGTGG - Exonic
1174956076 20:55100184-55100206 TTTGCAGATGGCCCTATTGTGGG - Intergenic
1179017734 21:37607621-37607643 TTGGCTCCTGTCCCATTTTTTGG - Exonic
1181753785 22:25008584-25008606 TTGGCAACTGGCCCATGTGGTGG - Intronic
1182464682 22:30506972-30506994 CTGGCACCTGGCACTTTGGGAGG + Intergenic
1183851158 22:40589351-40589373 TAGGCATTTGGCACTTTTGTTGG - Intronic
1184206225 22:43005437-43005459 TTGGCACCTGGCCCTTTTGTTGG - Intronic
950550484 3:13663189-13663211 TTTTCACCTGCCCCATTTGTGGG - Intergenic
950720860 3:14881716-14881738 TGTGCACCTGGACATTTTGTAGG + Intronic
950966471 3:17150125-17150147 TTGGCTCCAGGCTCTTTTCTGGG - Intergenic
955027378 3:55182833-55182855 TTCTCCCCTTGCCCTTTTGTAGG + Intergenic
959851205 3:111089021-111089043 TTGGCACTTAGCATTTTTGTGGG + Intronic
960946033 3:122967418-122967440 TTGGTGCCTGCCCCATTTGTGGG + Intronic
969436995 4:7194024-7194046 GTGGCCCTTGGCCCTTTTGTGGG - Intronic
975740599 4:77425536-77425558 TTGGCACCTTGGCCTCTGGTTGG + Intronic
982147874 4:152417537-152417559 TTGCCACCTTGCCCCCTTGTTGG - Intronic
983780738 4:171667183-171667205 GTGGCACCAGGCCCTCTTGAAGG - Intergenic
984970894 4:185188946-185188968 ACTGCATCTGGCCCTTTTGTAGG - Intronic
992971085 5:82058808-82058830 TTGGATCCTGGGCCTGTTGTAGG + Intronic
995202363 5:109440541-109440563 TAGGAACTTGTCCCTTTTGTAGG + Intergenic
995301177 5:110585190-110585212 TTGGTAACTGTTCCTTTTGTTGG - Intronic
996088867 5:119330952-119330974 TTGGCTCTTGGCCTTTTTCTTGG - Intronic
998757673 5:145398631-145398653 TATGCACTTGGCCCTTTTCTAGG + Intergenic
1002363904 5:178695360-178695382 TTGGCACCTTGGCCTCTGGTTGG + Intergenic
1002585576 5:180244925-180244947 TTGGCCCCTGGGCCTTGTGATGG - Intronic
1002900932 6:1409111-1409133 TGAGTACTTGGCCCTTTTGTGGG - Intergenic
1003055120 6:2811168-2811190 TTTGCACCTGGATCTTTTGCTGG - Intergenic
1006269263 6:32951289-32951311 TTGCCAACTGGCCTTTTTATAGG - Intronic
1006415586 6:33901889-33901911 TGTGCTCCTTGCCCTTTTGTAGG - Intergenic
1007000621 6:38309078-38309100 ACTGCACCTGGCCTTTTTGTGGG - Intronic
1008872540 6:56289729-56289751 TTAGCCCCTGGCCCCTTTCTTGG + Intronic
1019517185 7:1445232-1445254 TTGCCTCCTGGGCCTTCTGTGGG + Exonic
1023788153 7:43729093-43729115 TTGGGACTGGGCACTTTTGTTGG - Intronic
1024923561 7:54587518-54587540 TTGTCACCTGACCTCTTTGTTGG + Intergenic
1026812283 7:73478286-73478308 TTGGCAGGTGGGCCTTTTTTAGG + Exonic
1027223981 7:76232687-76232709 TTGGCTCCAGGCCCTTTCCTGGG - Intronic
1036116295 8:5963794-5963816 ATGGCTCCTGGCCCTTCTGCAGG - Intergenic
1038161301 8:25041438-25041460 TAGGAAACTGGCCCTTTGGTAGG - Intergenic
1038226833 8:25665646-25665668 TTAGCATATGTCCCTTTTGTGGG + Intergenic
1038266160 8:26041268-26041290 TTGGCAAGTGGTCCTGTTGTCGG - Intronic
1039948906 8:42152889-42152911 TTGGCGGCTTGCCCTGTTGTCGG - Intergenic
1055498701 9:76881908-76881930 ACCGCACCTGGCCCTTTTCTGGG + Intronic
1056108241 9:83369140-83369162 ATGACACCTGGCCCATTTCTAGG + Intronic
1056389450 9:86127193-86127215 TTGGCTTGTTGCCCTTTTGTTGG - Intergenic
1056987503 9:91377056-91377078 CAGGCACCTGGGCCTGTTGTGGG - Intergenic
1057098333 9:92333057-92333079 TTAGCAGCTGGACCTTTTGCTGG + Intronic
1058613844 9:106804822-106804844 TTTGCACCTTCCCCTTATGTAGG + Intergenic
1058949461 9:109890232-109890254 TTGGCTCCGGGCCCTTGTGATGG - Intronic
1060005831 9:119998581-119998603 TACGCACCTGGCCCTGTTGCAGG + Intergenic
1060054999 9:120405544-120405566 TCTGCACCTGGCCCTTTTTAAGG - Intronic
1190445911 X:50523909-50523931 TTGCCACCTACTCCTTTTGTTGG + Intergenic
1193745964 X:85281556-85281578 ATGTCACCTGGCCATTTTGGAGG + Intronic
1194801630 X:98280689-98280711 ATGCCACCTGCCCCTCTTGTAGG + Intergenic
1201912401 Y:19146191-19146213 CTGGTACCTTGCCTTTTTGTAGG - Intergenic