ID: 1184207758

View in Genome Browser
Species Human (GRCh38)
Location 22:43015621-43015643
Sequence GGACCCGCTTAGTTTAAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184207752_1184207758 7 Left 1184207752 22:43015591-43015613 CCGACTTGCGCCAAAAGCGTCAT No data
Right 1184207758 22:43015621-43015643 GGACCCGCTTAGTTTAAACGGGG No data
1184207754_1184207758 -3 Left 1184207754 22:43015601-43015623 CCAAAAGCGTCATTCCACGTGGA No data
Right 1184207758 22:43015621-43015643 GGACCCGCTTAGTTTAAACGGGG No data
1184207751_1184207758 10 Left 1184207751 22:43015588-43015610 CCTCCGACTTGCGCCAAAAGCGT No data
Right 1184207758 22:43015621-43015643 GGACCCGCTTAGTTTAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184207758 Original CRISPR GGACCCGCTTAGTTTAAACG GGG Intergenic
No off target data available for this crispr