ID: 1184211390

View in Genome Browser
Species Human (GRCh38)
Location 22:43037694-43037716
Sequence TTTTCAACACAAATGGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184211390_1184211392 -2 Left 1184211390 22:43037694-43037716 CCAAGTACCATTTGTGTTGAAAA No data
Right 1184211392 22:43037715-43037737 AAGACCTATTTTTCCCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184211390 Original CRISPR TTTTCAACACAAATGGTACT TGG (reversed) Intergenic
No off target data available for this crispr