ID: 1184214766

View in Genome Browser
Species Human (GRCh38)
Location 22:43059437-43059459
Sequence TGCTGGTCACCTCCTTGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184214764_1184214766 0 Left 1184214764 22:43059414-43059436 CCAGTGGATCTCGTCGAACAGCT 0: 1
1: 0
2: 0
3: 1
4: 45
Right 1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG 0: 1
1: 0
2: 0
3: 15
4: 125
1184214761_1184214766 28 Left 1184214761 22:43059386-43059408 CCACAGCCTTCAGGGACTGCACG 0: 1
1: 0
2: 1
3: 40
4: 283
Right 1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG 0: 1
1: 0
2: 0
3: 15
4: 125
1184214762_1184214766 22 Left 1184214762 22:43059392-43059414 CCTTCAGGGACTGCACGATGATC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG 0: 1
1: 0
2: 0
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184214766 Original CRISPR TGCTGGTCACCTCCTTGCCG CGG Exonic
900122494 1:1054746-1054768 TGCTGGTCACCTGCTCGTTGGGG + Intronic
901219547 1:7575570-7575592 GGCTAGTCACCTCCCTGCCCAGG + Intronic
904857360 1:33509490-33509512 TGCTCCTCACCTCCTAGACGGGG + Intergenic
909669960 1:78177330-78177352 AGCTGGTCACCTCCTTTACATGG + Intergenic
916320590 1:163499332-163499354 TGCTGCTCACTTCCTAGACGGGG + Intergenic
917860090 1:179135988-179136010 TGCCCGTCACCTCCTGGACGGGG - Intronic
920804615 1:209220804-209220826 TGCTGGGCACCCCTTTGCCAAGG + Intergenic
924879641 1:248146023-248146045 CTCTGGTCACCTCCTTGTTGCGG - Exonic
924884899 1:248203943-248203965 CTCTGGTCACCTCCTTGTTGCGG - Exonic
1067232444 10:44421556-44421578 TGCCTGTCACCTCCTTCCAGGGG + Intergenic
1070568791 10:77625004-77625026 TGCTGGTCATCTCCTGGAGGGGG + Intronic
1070585619 10:77763821-77763843 TGGTGCTCACCTGCTTGCTGGGG - Intergenic
1076521912 10:131086563-131086585 TGCCTGTCTCCTCCTTGCCCAGG - Intergenic
1076782154 10:132730308-132730330 CGCTGGTGTCCTGCTTGCCGGGG + Intronic
1077032563 11:476106-476128 TGCTGGCCCCTTCCTTGCCCAGG + Intronic
1077232310 11:1463263-1463285 TGCTGGCCTCCTCCAGGCCGCGG - Intergenic
1079085599 11:17442753-17442775 GGCTGGTCATCTCCTTCCTGCGG + Exonic
1082073864 11:47961474-47961496 TGCTGGACACCTCCCTCCAGAGG - Intergenic
1083673857 11:64314823-64314845 TGATGGGCACCTCCCAGCCGTGG + Exonic
1084590747 11:70088696-70088718 TTCTGGTCAGCTCCTTTCCTGGG + Intronic
1084858874 11:72005411-72005433 GGCAGGTCACCTCCTGGCCCTGG + Intronic
1085344605 11:75760090-75760112 TGCTGATCACCTCCCTGCTCAGG + Intronic
1091989264 12:4941482-4941504 TGCGTGTCACCTACTTGCTGAGG - Intergenic
1092712592 12:11353780-11353802 GGCTGGTTACCTCCTTGTGGGGG + Exonic
1100784674 12:98066293-98066315 TGCTGGTCTCTTCCTTGCCTTGG + Intergenic
1101145760 12:101839111-101839133 GCCTGGTGACCTCCTTGCCTTGG - Intergenic
1102443047 12:112978238-112978260 GGCTGGTCACCACGCTGCCGGGG + Intergenic
1110231481 13:73172036-73172058 GGATGGAGACCTCCTTGCCGTGG + Intergenic
1114267614 14:21081979-21082001 TGCTGGTGACCTCCAGGCCTCGG - Exonic
1115769448 14:36655212-36655234 TGCTCGTCTCCTCCTGGCCCCGG - Intergenic
1116132729 14:40878893-40878915 TTCTGTTCACCTCCTTGCCCAGG + Intergenic
1119347810 14:73940855-73940877 TGCTGGAAACCTCCCTGCCAAGG - Intronic
1119725245 14:76918352-76918374 TGCTGGTCCCCTCCCTCCCCTGG + Intergenic
1124253187 15:28120952-28120974 TGCTGCTCTCCTCCCTGCCATGG - Intronic
1125956540 15:43794409-43794431 TGCTGCTCACCGACTTCCCGTGG + Exonic
1127898813 15:63326125-63326147 TGCTGGGTGCCTCCTTGCCTTGG - Exonic
1128797239 15:70474873-70474895 AGCTGGTCACGTCCTCACCGGGG + Intergenic
1132551624 16:556070-556092 TGCTGGCCACAGCCTTCCCGGGG + Intergenic
1132570084 16:640759-640781 TGCTGGGCTCCTCTGTGCCGAGG - Intronic
1132889817 16:2197903-2197925 TGCTGGTCACCTCCTAGATGAGG + Intergenic
1133631868 16:7629507-7629529 TTCTGGTCACTTCCTTGACTGGG - Intronic
1134016383 16:10891328-10891350 TGCAAGTCACGTCCTTCCCGGGG + Intronic
1134092976 16:11401383-11401405 TGCTGGTCTCCTCCTCCCTGTGG - Exonic
1134110775 16:11514319-11514341 TGGTGGCCACCCCCTGGCCGTGG - Intronic
1136071058 16:27787398-27787420 TTCTGGGCACCTCCTGGGCGGGG - Intergenic
1136775254 16:32868353-32868375 GGCTGGGCAGCTCCTTGCCGGGG + Intergenic
1136895362 16:33993159-33993181 GGCTGGGCAGCTCCTTGCCGGGG - Intergenic
1137745544 16:50817545-50817567 TGCTGGCCACCTCCATTCCAAGG - Intergenic
1138307210 16:55988982-55989004 TGCTCCTCACTTCCTGGCCGGGG - Intergenic
1139590017 16:67928321-67928343 TGCTGGTCATCGGCTTGCCCAGG + Exonic
1203077671 16_KI270728v1_random:1130462-1130484 GGCTGGGCAGCTCCTTGCCGGGG + Intergenic
1143614362 17:8040691-8040713 TGCTGGTGTCTTCCTTGCCCTGG + Intronic
1144684260 17:17215818-17215840 TGCTGGTCACCGCTGTGCTGGGG + Intronic
1144890192 17:18489977-18489999 GGCTGCCCACCTCCTTGTCGTGG - Intronic
1145118312 17:20232370-20232392 TGCTGGTGACCACCCTGCCGTGG - Exonic
1145142024 17:20454341-20454363 GGCTGCCCACCTCCTTGTCGTGG + Intronic
1145775699 17:27526885-27526907 TGCTGGTGATCTCCTTCCCTAGG + Intronic
1145793880 17:27644558-27644580 GGCTGCTCACCTCCTTGTCCTGG - Intronic
1145808687 17:27752111-27752133 GGCTGCTCACCTCCTTGTCCTGG - Intergenic
1146648252 17:34589784-34589806 GGCAGGTCACCTCCTTGGCTAGG - Intronic
1146884473 17:36461963-36461985 TGCTGTTCATGTCCTTGCCATGG + Intergenic
1147604207 17:41764781-41764803 TGCTGGTCAGGTGCTTGCCCAGG + Exonic
1154003643 18:10506984-10507006 TGCTGCTCACTTCCTAGACGGGG + Intergenic
1154302628 18:13207689-13207711 GGTTGGTCACCTCCCTGCCAGGG - Intergenic
1158567941 18:58570960-58570982 TTCTGGTCACTTTCTTGCCAGGG - Intronic
1161516504 19:4699581-4699603 TGCTGGTGACCGCCTTGCTGCGG + Intronic
1161887236 19:7006220-7006242 CTCTGGTCACCTCCATGCCAGGG + Intergenic
1161887968 19:7011682-7011704 CTCTGGTCACCTCCATGCCAGGG - Intergenic
926146581 2:10400177-10400199 TGCTCGCCCCCTCCTTGCCACGG - Intronic
926883531 2:17575214-17575236 TGCTGGTCACCTCCCAACCCGGG + Intronic
927468569 2:23355175-23355197 TCCAAGTCACCTCCTTGCTGGGG - Intergenic
929831271 2:45348688-45348710 TGCAGGCCAACTCCTTGCCTGGG - Intergenic
931519549 2:63080627-63080649 GGCTGGTCTCCTCTTTGCCATGG + Intergenic
934951329 2:98577462-98577484 TGTTGGCCACCTGCTGGCCGTGG + Intronic
938242654 2:129755347-129755369 TGCTGGCCCCATCCTTGCCGAGG + Intergenic
938391750 2:130912197-130912219 CACTGGTCCTCTCCTTGCCGTGG + Intronic
940635569 2:156293555-156293577 TGCTCCTCACCTCCTAGACGGGG - Intergenic
940821446 2:158360271-158360293 TGCCTGTCAGCTCCTTGCAGCGG + Intronic
942625648 2:177897412-177897434 TGCTGTTCACTTCCCTGCAGGGG - Intronic
943125915 2:183792926-183792948 TGCTGCTCACTTCCTAGACGGGG + Intergenic
946301077 2:218824393-218824415 TCCTAGTCACCCCCTTGCCTGGG + Intronic
948768593 2:240235972-240235994 TGCTGGGCACCTCGCTGCCTGGG + Intergenic
1170290333 20:14762105-14762127 GGCTGATCACTTCCTTGCCTGGG + Intronic
1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG + Intronic
1175442562 20:59001910-59001932 TGCTGGTGACCGCCTGGCCCTGG - Intronic
1179503688 21:41825547-41825569 TGCCGGTCTCCTCCGTGCAGTGG - Intronic
1179659164 21:42863572-42863594 GGCTGTACACCTCCTTGCCACGG + Exonic
1181257680 22:21574461-21574483 GGCTGGTCACCTCCCTGCCCTGG - Intronic
1181512411 22:23394809-23394831 GCCTGGCCACCTCCTTGCTGGGG - Intergenic
1182062496 22:27407940-27407962 TGCTGGCCACATCCTTCCCCTGG + Intergenic
1182145914 22:27996616-27996638 TGCTCATCTCCTCCTTGCCATGG + Intronic
1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG + Exonic
1184468922 22:44684607-44684629 TGAGGGTCACCTCCTACCCGCGG + Intronic
954134461 3:48575616-48575638 TTCTGCTCACCTCCTTGCCTGGG + Exonic
954821400 3:53332047-53332069 TGCTGCTCACCACCTTGCTGAGG + Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
958407264 3:93764845-93764867 TGCTGCTCACTTCCTAGACGGGG + Intergenic
960798637 3:121514911-121514933 TGATGGTCATCTCCTTTCCTGGG - Intronic
960962483 3:123082142-123082164 TGCTGGGACCCTCCTTGCCCTGG + Intronic
961467245 3:127089340-127089362 TGCTGGTCCCCTCCAGGCTGGGG - Intergenic
964426376 3:156558476-156558498 TTCTGGTCTCCTCCATGCAGTGG + Intergenic
965897677 3:173597059-173597081 GGCTGCTCATCTGCTTGCCGGGG - Intronic
966910870 3:184559312-184559334 AGGTGGTCACCTTCTTGCCCTGG + Intronic
967300194 3:188005016-188005038 TGGTGGTCACCTCAATGCCTAGG - Intergenic
968084388 3:195867951-195867973 GGCTGGTCTCCTCCTCGCCCGGG + Exonic
969639442 4:8388196-8388218 GGCTGGTGACCACCTTGCAGGGG - Intronic
970054266 4:11952791-11952813 TGCTGTTCTACTCCTTACCGAGG - Intergenic
972700864 4:41491977-41491999 TGCTGCTCACTTCCTAGACGGGG + Intronic
984935289 4:184884325-184884347 TGCTGATCAGGTCCTTGCAGTGG + Intergenic
986337777 5:6767892-6767914 AGCTGCTCACCTCCCTGCAGAGG - Intergenic
988555345 5:32231694-32231716 TCCTGGTCACCTCCGAGCTGTGG - Intronic
995183741 5:109251363-109251385 TGCTGAACACCTCCTTTCTGGGG + Intergenic
998069884 5:139189205-139189227 TGCTGCTCACCTCCTTGGATGGG - Intronic
1000252644 5:159510253-159510275 TGCTGGTCTGCTTCCTGCCGAGG + Intergenic
1004200259 6:13541658-13541680 TGCTAAGCACCTCATTGCCGGGG - Intergenic
1005854569 6:29851231-29851253 TCCTGGTCCCCTCCCTGCCTAGG - Intergenic
1007075238 6:39062027-39062049 TGCTGGCCACCTCGTTGCCAGGG + Intronic
1009869245 6:69433636-69433658 TGCTGCTCACTTCCTAGACGGGG + Intergenic
1012790525 6:103688323-103688345 TGGTGCTCACCTGGTTGCCGCGG - Intergenic
1020603490 7:10306102-10306124 TTCTGGTCACCACTTTGCTGTGG - Intergenic
1021564025 7:21999147-21999169 TGGTAGTCACCTCCTTGACCGGG + Intergenic
1022174909 7:27863467-27863489 CCCTGATCACCTCCCTGCCGAGG + Intronic
1022665974 7:32410763-32410785 TGCTGGGCACCTCCTTCTCCAGG + Intergenic
1023797816 7:43808354-43808376 TGCAGGTCACCTACTTGCAGAGG - Intergenic
1026000588 7:66557164-66557186 TGACGTTCACCTCCTTCCCGGGG + Intergenic
1035491649 7:159284652-159284674 TGCTGGTCACCTCTTCCCCTGGG - Intergenic
1036502882 8:9329456-9329478 TGTTTTTCAGCTCCTTGCCGAGG - Intergenic
1039573680 8:38606348-38606370 TTCAGGTCACCTCCTTGGCTTGG + Intergenic
1042078200 8:65019125-65019147 GGCTGGACAGCTCCTTGCCTGGG + Intergenic
1047387330 8:124422129-124422151 ACCTGATCACCTCCTGGCCGAGG + Intergenic
1047422922 8:124722003-124722025 TGCTGCCCACCTCCATGCCCAGG + Intronic
1047954295 8:129961485-129961507 TGCTGGTTGCCTCCTTACAGAGG + Intronic
1050101878 9:2128247-2128269 TGCTGGTCTGCTCCTTTCCTGGG + Intronic
1055647602 9:78375745-78375767 TCCTGAGCACCTCCTTGCCTTGG + Intergenic
1060138420 9:121181379-121181401 TGCTAGTGACCTCTTTGCTGTGG - Exonic
1060454452 9:123778710-123778732 AGCTGGTCACATCCTGCCCGGGG - Intronic
1061181977 9:129029691-129029713 TGTAGGTCATCTCCTTGCCTGGG - Intergenic
1186596726 X:10989696-10989718 TGCTGGTGACCTCAGTGCCCAGG - Intergenic
1192087120 X:68111392-68111414 TTCTGGTCAACTTCTTGCCATGG - Intronic
1200104666 X:153705705-153705727 GGCTGGGCAGCTCCTTGCCGGGG - Intronic
1201294860 Y:12454035-12454057 TGCTGCTCACTTCCTAGACGGGG + Intergenic