ID: 1184217270

View in Genome Browser
Species Human (GRCh38)
Location 22:43076055-43076077
Sequence CCCACTCACCCATCGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184217270_1184217274 8 Left 1184217270 22:43076055-43076077 CCGACTTCCGATGGGTGAGTGGG No data
Right 1184217274 22:43076086-43076108 TGCCTGTCCCACATCCCTCCAGG 0: 1
1: 0
2: 3
3: 42
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184217270 Original CRISPR CCCACTCACCCATCGGAAGT CGG (reversed) Intronic
No off target data available for this crispr