ID: 1184219800

View in Genome Browser
Species Human (GRCh38)
Location 22:43092540-43092562
Sequence TTTGCAAATGTACAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184219800_1184219805 20 Left 1184219800 22:43092540-43092562 CCAACCAACTGTACATTTGCAAA No data
Right 1184219805 22:43092583-43092605 AAAAAAGAGGCCAGGCGCGGTGG 0: 27
1: 549
2: 3304
3: 12615
4: 52656
1184219800_1184219804 17 Left 1184219800 22:43092540-43092562 CCAACCAACTGTACATTTGCAAA No data
Right 1184219804 22:43092580-43092602 TCAAAAAAAGAGGCCAGGCGCGG No data
1184219800_1184219802 7 Left 1184219800 22:43092540-43092562 CCAACCAACTGTACATTTGCAAA No data
Right 1184219802 22:43092570-43092592 CTTTATTAAATCAAAAAAAGAGG No data
1184219800_1184219803 12 Left 1184219800 22:43092540-43092562 CCAACCAACTGTACATTTGCAAA No data
Right 1184219803 22:43092575-43092597 TTAAATCAAAAAAAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184219800 Original CRISPR TTTGCAAATGTACAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr