ID: 1184219803

View in Genome Browser
Species Human (GRCh38)
Location 22:43092575-43092597
Sequence TTAAATCAAAAAAAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184219800_1184219803 12 Left 1184219800 22:43092540-43092562 CCAACCAACTGTACATTTGCAAA No data
Right 1184219803 22:43092575-43092597 TTAAATCAAAAAAAGAGGCCAGG No data
1184219801_1184219803 8 Left 1184219801 22:43092544-43092566 CCAACTGTACATTTGCAAAAATA No data
Right 1184219803 22:43092575-43092597 TTAAATCAAAAAAAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184219803 Original CRISPR TTAAATCAAAAAAAGAGGCC AGG Intergenic
No off target data available for this crispr