ID: 1184222514

View in Genome Browser
Species Human (GRCh38)
Location 22:43110095-43110117
Sequence CCCGGAGCCCCGACGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184222498_1184222514 5 Left 1184222498 22:43110067-43110089 CCTCCCAGTCCCGCCCGCCTCTC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222492_1184222514 18 Left 1184222492 22:43110054-43110076 CCTGCCCCCAATCCCTCCCAGTC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222499_1184222514 2 Left 1184222499 22:43110070-43110092 CCCAGTCCCGCCCGCCTCTCGCG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222490_1184222514 20 Left 1184222490 22:43110052-43110074 CCCCTGCCCCCAATCCCTCCCAG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222497_1184222514 6 Left 1184222497 22:43110066-43110088 CCCTCCCAGTCCCGCCCGCCTCT No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222503_1184222514 -5 Left 1184222503 22:43110077-43110099 CCGCCCGCCTCTCGCGGACCCGG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222489_1184222514 21 Left 1184222489 22:43110051-43110073 CCCCCTGCCCCCAATCCCTCCCA No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222491_1184222514 19 Left 1184222491 22:43110053-43110075 CCCTGCCCCCAATCCCTCCCAGT No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222494_1184222514 13 Left 1184222494 22:43110059-43110081 CCCCAATCCCTCCCAGTCCCGCC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222493_1184222514 14 Left 1184222493 22:43110058-43110080 CCCCCAATCCCTCCCAGTCCCGC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222495_1184222514 12 Left 1184222495 22:43110060-43110082 CCCAATCCCTCCCAGTCCCGCCC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222505_1184222514 -8 Left 1184222505 22:43110080-43110102 CCCGCCTCTCGCGGACCCGGAGC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222506_1184222514 -9 Left 1184222506 22:43110081-43110103 CCGCCTCTCGCGGACCCGGAGCC No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222502_1184222514 -4 Left 1184222502 22:43110076-43110098 CCCGCCCGCCTCTCGCGGACCCG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222496_1184222514 11 Left 1184222496 22:43110061-43110083 CCAATCCCTCCCAGTCCCGCCCG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data
1184222500_1184222514 1 Left 1184222500 22:43110071-43110093 CCAGTCCCGCCCGCCTCTCGCGG No data
Right 1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184222514 Original CRISPR CCCGGAGCCCCGACGGGAGG GGG Intergenic
No off target data available for this crispr