ID: 1184228235

View in Genome Browser
Species Human (GRCh38)
Location 22:43143039-43143061
Sequence CGTGCTGGGCTACGACCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184228235_1184228245 13 Left 1184228235 22:43143039-43143061 CCAGCAGGTCGTAGCCCAGCACG 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1184228245 22:43143075-43143097 CGTAGAGTTCGCGGACGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 14
1184228235_1184228240 -10 Left 1184228235 22:43143039-43143061 CCAGCAGGTCGTAGCCCAGCACG 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1184228240 22:43143052-43143074 GCCCAGCACGCGGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 31
4: 292
1184228235_1184228243 4 Left 1184228235 22:43143039-43143061 CCAGCAGGTCGTAGCCCAGCACG 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1184228243 22:43143066-43143088 GGGCGGCGGCGTAGAGTTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 60
1184228235_1184228244 12 Left 1184228235 22:43143039-43143061 CCAGCAGGTCGTAGCCCAGCACG 0: 1
1: 0
2: 1
3: 10
4: 70
Right 1184228244 22:43143074-43143096 GCGTAGAGTTCGCGGACGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184228235 Original CRISPR CGTGCTGGGCTACGACCTGC TGG (reversed) Exonic
901012424 1:6209307-6209329 CGTGCAGGGCTGCGAGCGGCTGG + Exonic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
904285924 1:29453262-29453284 CCTGCTGGACTCCGACCTCCAGG - Intergenic
911039733 1:93582321-93582343 CGTGCTGGGCGATGACCTTGGGG + Exonic
912517106 1:110223389-110223411 CGTGCTGGGCCACACCCTGAGGG + Exonic
912771013 1:112464530-112464552 AGGGCTGGGCTAGGAACTGCTGG - Intergenic
919973641 1:202596921-202596943 CGTGCTGGACTATGACAAGCTGG - Exonic
923111671 1:230895679-230895701 CGTGCTGGTCTTAGAACTGCTGG - Intergenic
1063407754 10:5813213-5813235 CGTGCTGGGCACCGGCCTGACGG - Exonic
1063470363 10:6279837-6279859 GGTGCTGGGCTACTCTCTGCTGG + Intergenic
1074311351 10:112325806-112325828 CGTGCCCGGCCAAGACCTGCTGG - Intergenic
1075096043 10:119472046-119472068 GGTGCTGGGCTACGCCTTGGTGG + Intergenic
1075600239 10:123762097-123762119 TGTGCTGGGCGGCAACCTGCAGG - Exonic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1083743640 11:64723527-64723549 CGCGCTGCGCGAAGACCTGCTGG - Intergenic
1090840951 11:130487159-130487181 CGTGCTGGGCCTCTCCCTGCAGG + Intergenic
1096179102 12:49540909-49540931 CGTGCTGGGCAACGCCCAGGTGG + Exonic
1097054892 12:56243377-56243399 AGTGCTGGGGTGTGACCTGCAGG + Exonic
1107357136 13:39579369-39579391 CCTGCTGGGTCATGACCTGCTGG - Intronic
1114430560 14:22657014-22657036 CATGCTGGGCCAGGAGCTGCAGG - Intergenic
1129452126 15:75657053-75657075 CGTGGTGGGTTTCGCCCTGCAGG + Exonic
1130665028 15:85862234-85862256 CGTTCTGGGCTGGGAACTGCTGG + Intergenic
1132481130 16:166603-166625 CGTGCTGGCCTCCCACCTGCAGG + Exonic
1132579351 16:678004-678026 CGTCTTCGCCTACGACCTGCTGG + Exonic
1132601498 16:775035-775057 CCCGCTGGGCGCCGACCTGCTGG - Exonic
1132798654 16:1740746-1740768 GGTGCTGGGGGACGACCAGCAGG + Intronic
1132869890 16:2111281-2111303 CGTGCTGGTCTTCGTCCTGGAGG - Exonic
1134062283 16:11206358-11206380 CGTGCTGGGCTACATACTGCTGG + Intergenic
1134097163 16:11425383-11425405 TGTGCTGGGCTTCCTCCTGCGGG - Exonic
1134717532 16:16364320-16364342 CGTGCTGGTCTTCGTCCTGGAGG + Intergenic
1134957220 16:18387839-18387861 CGTGCTGGTCTTCGTCCTGGAGG - Intergenic
1135400261 16:22162247-22162269 CGTGCCGGGCTCTGTCCTGCAGG - Intergenic
1136553604 16:30995185-30995207 CGGGCTGGTCTACGAACTCCTGG + Intronic
1141763281 16:86043106-86043128 CGTCTTGGGCTCCCACCTGCTGG + Intergenic
1151715472 17:75828910-75828932 CGTGCTGGACTACGACACGCTGG - Exonic
1152877181 17:82793576-82793598 CATGCTGGGCTGCACCCTGCAGG - Intronic
1161028967 19:2049286-2049308 CCTGCTGGGCTGCTGCCTGCTGG + Intronic
1161484943 19:4530376-4530398 GGTGCTGGGCTAGGACCCTCAGG + Intronic
1161556400 19:4945079-4945101 CGTGCAGGGCTAGGAGCTCCTGG + Intronic
1162141699 19:8589326-8589348 AGTCCTGGGCTCCGACCTGCGGG - Exonic
1162236600 19:9314556-9314578 CGCTCTGGGCTACTTCCTGCCGG + Intergenic
1163946098 19:20536477-20536499 CGTGCTTTCCTAGGACCTGCTGG - Intronic
1164240522 19:23384357-23384379 CGTGGTGGGCGGTGACCTGCAGG - Intronic
1165059029 19:33195806-33195828 TGTGCTGGGCTCTGAGCTGCTGG + Intronic
1166996796 19:46723255-46723277 CGTGCTGAGCCACGTCCTGGAGG - Exonic
1168138354 19:54366992-54367014 GCTGCTGGGCAACGACTTGCTGG + Intronic
1168257235 19:55173642-55173664 CGTGCTGGACTACGACAAGCTGG - Exonic
1168315370 19:55482594-55482616 CGGGCTGCGCTACCACCTGCGGG + Exonic
927240610 2:20916943-20916965 CCTGCTGAGCTACCACCTGCTGG - Intergenic
948826459 2:240575531-240575553 CGTGGTGGCCCAGGACCTGCTGG + Exonic
1170599720 20:17831943-17831965 CTGGCTGGGCTACCACCTGTGGG - Intergenic
1170602151 20:17849284-17849306 CGTGCTGGGCTTTGACCTGCTGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1180055008 21:45353060-45353082 AGTGCAGGGCCAGGACCTGCCGG - Intergenic
1182585982 22:31344660-31344682 CGTGCTGGGCCTCGTGCTGCCGG + Exonic
1184228235 22:43143039-43143061 CGTGCTGGGCTACGACCTGCTGG - Exonic
1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG + Intronic
1185253387 22:49817525-49817547 TGTGATGGGCTAGGACCAGCAGG + Intronic
950872718 3:16243369-16243391 CGAGCTGGGCTCTGACCTGAGGG - Intergenic
954491435 3:50910441-50910463 TGTGCTGGGCTAAGAGCTGCTGG - Intronic
961556063 3:127697300-127697322 TGTGCAGGGCTGCGACATGCAGG + Intronic
964005681 3:151825091-151825113 AGTGCTGAGCTACCACATGCAGG - Intronic
967874286 3:194256198-194256220 TGTGCTGGGCTCCGTCCTGGGGG + Intergenic
968248684 3:197183818-197183840 CCTGCTTGGCAACCACCTGCAGG - Intronic
968869262 4:3233261-3233283 TGTGCTGGAGTGCGACCTGCTGG + Exonic
969695498 4:8731931-8731953 CGTGCTGGACTACGAGCTCCAGG + Intergenic
981449788 4:144883439-144883461 CCTGCTGGGTTACCAACTGCTGG + Intergenic
987545868 5:19309676-19309698 GGTGCTGGGTTACAAGCTGCTGG + Intergenic
1004160179 6:13205951-13205973 GGTGCTGGGCCACACCCTGCTGG - Exonic
1018983766 6:168619942-168619964 CGAGCTGGACAACGGCCTGCCGG - Intronic
1019551378 7:1604349-1604371 AGTGCTGAGCTACCACCTCCCGG + Intergenic
1025606807 7:63045215-63045237 CGAGCTGGGCTATGAGCTCCTGG - Intergenic
1029529457 7:101115629-101115651 CGTGCTGGGCCAGGGCCTGCTGG - Intergenic
1037879281 8:22565303-22565325 CGAGCTGGACAAGGACCTGCGGG + Exonic
1042701317 8:71618157-71618179 GGTGCTGGCCTCCGTCCTGCAGG + Intergenic
1048925151 8:139264893-139264915 CTTGCTGGGCTGCAACCTGAGGG - Intergenic
1059290680 9:113221347-113221369 CGTGCTGGAGTTCGCCCTGCCGG - Exonic
1060793735 9:126501635-126501657 GGTGCTGGGCTGTGACTTGCTGG + Intronic
1061537748 9:131260033-131260055 GGTGCAGGGATACGACCTGGGGG + Exonic
1062621381 9:137423828-137423850 CCTGCTCGGCTCCCACCTGCCGG - Intronic
1186247713 X:7631847-7631869 AGTGCTGGGCTGAGACCTGTGGG + Intergenic
1196071171 X:111523955-111523977 CGTACTGGGCTAGGCTCTGCAGG + Intergenic