ID: 1184230749

View in Genome Browser
Species Human (GRCh38)
Location 22:43157188-43157210
Sequence ATGAAAGGCCACCCTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230749_1184230761 30 Left 1184230749 22:43157188-43157210 CCCCAGGGAGGGTGGCCTTTCAT 0: 1
1: 0
2: 2
3: 16
4: 156
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230749 Original CRISPR ATGAAAGGCCACCCTCCCTG GGG (reversed) Intronic
903357925 1:22759460-22759482 ATGAAATCCCACCATCCCTTGGG - Intronic
903728417 1:25470511-25470533 ATGAAAGGCCACCTGCCCCTGGG - Intronic
905902738 1:41592566-41592588 GTAAAAGGCAACCCTCCCCGTGG + Intronic
907299678 1:53478771-53478793 GTGAAAGGCCCCTCTCCCTATGG + Intergenic
908469720 1:64431794-64431816 AGAAAATGCCACCCTCCCTAAGG - Intergenic
911050308 1:93665285-93665307 TTTCAGGGCCACCCTCCCTGGGG - Intronic
918748202 1:188234089-188234111 ATGAAAAGCCACACTGCCTATGG + Intergenic
919189300 1:194195257-194195279 ATGAAAGGCCTCACTCCAAGAGG - Intergenic
920035678 1:203063868-203063890 ATGAATGGCTACCCAGCCTGGGG + Exonic
920438679 1:205964279-205964301 ATGAAAGTCCACCAACCATGTGG - Intergenic
1063098738 10:2931399-2931421 ATGAAATGCGACCCTCTCTAAGG - Intergenic
1067393732 10:45891130-45891152 ATGAAAGGTCAGCATTCCTGTGG + Intergenic
1067661342 10:48238180-48238202 ATGAAAGACCACCCGCACAGGGG + Intronic
1067862056 10:49860286-49860308 ATGAAAGGTCAGCATTCCTGTGG + Intronic
1071787288 10:88915959-88915981 GAGAAAGGCCAGCCTGCCTGGGG + Intronic
1072627729 10:97124348-97124370 CTGACAGACCCCCCTCCCTGGGG - Intronic
1077154819 11:1086539-1086561 ATGAGAGACCACCCTGCCCGTGG - Intergenic
1078361957 11:10675967-10675989 ATGGGAGGCCAGCCTCCATGAGG - Intronic
1079709694 11:23666171-23666193 AGGAAAGTCCACCCTCTCAGAGG - Intergenic
1086529330 11:87765130-87765152 CTGAATGGCCTCCTTCCCTGTGG + Intergenic
1087103107 11:94384041-94384063 ATTACAGGCCAACATCCCTGAGG + Intronic
1088693842 11:112349608-112349630 AAGAAAGCCCACCCCCACTGAGG + Intergenic
1093281593 12:17202914-17202936 AGGAAAGGTCACACTCCGTGAGG - Intergenic
1093391784 12:18632796-18632818 ATTAATGCCCACCCACCCTGGGG + Intronic
1094550629 12:31447578-31447600 ATGTAAGGGCACCCACCTTGCGG - Exonic
1099529592 12:83761608-83761630 ATTACAGGCCTCCATCCCTGTGG + Intergenic
1101136527 12:101749692-101749714 AGGAAATGCCACCATCTCTGTGG - Intronic
1103907010 12:124332946-124332968 ATACATGCCCACCCTCCCTGGGG - Intronic
1104952761 12:132449698-132449720 CTGAAATGTCACCTTCCCTGCGG + Intergenic
1107970509 13:45637606-45637628 ATGTCAGGCCAACATCCCTGAGG - Intergenic
1108287926 13:48927270-48927292 AGGAAAAGCCACCCTCAGTGTGG + Intergenic
1110882394 13:80588149-80588171 AGGAAAGCCCACCCTCAATGTGG + Intergenic
1112874872 13:104024808-104024830 ATAAATGCTCACCCTCCCTGAGG + Intergenic
1113178638 13:107598781-107598803 TTAAAAGGCCACCTTACCTGAGG + Intronic
1117326370 14:54672507-54672529 ATGACAGGGCACCCTCTCAGGGG - Intronic
1119306721 14:73613594-73613616 ATGATTAGCCGCCCTCCCTGGGG + Intronic
1122112580 14:99512717-99512739 CTGAAAGGGCACCCCCACTGGGG + Exonic
1122858558 14:104571890-104571912 ATTTAATGCCACCTTCCCTGGGG - Intronic
1122906960 14:104806033-104806055 CTGAGAGGTCACCCTTCCTGGGG - Intergenic
1125483424 15:40095752-40095774 ATGTTAGGGCACCTTCCCTGGGG - Intronic
1125723973 15:41858815-41858837 GGGAAAGGCCACCCTTCCTCTGG - Intronic
1126764005 15:51995532-51995554 ATGATAGGCCTCTCTCCCTGGGG + Intronic
1126994791 15:54428771-54428793 ATCAAAGGGCACACTGCCTGGGG - Intronic
1127868015 15:63047645-63047667 ATCTCAGGCCAGCCTCCCTGGGG - Intronic
1129135465 15:73546017-73546039 TTGAAAGCCTACCTTCCCTGAGG - Intronic
1132146246 15:99431709-99431731 CTGATAGGCCGGCCTCCCTGCGG + Intergenic
1132331043 15:101012786-101012808 ATGATAGCCCATCCTCTCTGAGG - Intronic
1133398460 16:5466774-5466796 ATGGCAGGTCACACTCCCTGGGG - Intergenic
1137446291 16:48534604-48534626 ATGAATGGCCATCTTCCTTGTGG + Intergenic
1138079889 16:54080589-54080611 ATTCAAGGCCACCCTGCCTGTGG - Intronic
1138456556 16:57124580-57124602 ATGAACTGCCACCTTGCCTGTGG + Intronic
1140546691 16:75816552-75816574 ATAACAAGCCAGCCTCCCTGTGG - Intergenic
1141575810 16:84962917-84962939 AGGAAAGGCCCCCCTCCCCCAGG - Intergenic
1144123502 17:12179431-12179453 ACAAGAGGCCACACTCCCTGAGG + Intergenic
1145258212 17:21339187-21339209 AGGAGAAGCCTCCCTCCCTGTGG + Intergenic
1145318424 17:21748819-21748841 AGGAGAAGCCTCCCTCCCTGTGG - Intergenic
1149869817 17:60171345-60171367 ATGAAAGGCCACAGGCCCTGGGG + Intergenic
1150271367 17:63867626-63867648 ATTAAAGGCCACTCTTCCTCTGG - Intergenic
1150274901 17:63890496-63890518 ATTAAAGGCCACTCTTCCTCTGG - Intergenic
1150277034 17:63905262-63905284 ATTAAAGGCCACTCTTCCTCTGG - Intergenic
1151194134 17:72420036-72420058 CTGTAAAGCCACCCTCCCTGGGG + Intergenic
1159739026 18:72141765-72141787 CTGAAAGGGCACCGTCCCTGAGG + Intergenic
1162045779 19:7999384-7999406 ATAAAAGGCCACCTTCCCCCAGG + Intronic
1162779771 19:13000937-13000959 TTAAAAGGCCAGGCTCCCTGTGG - Intronic
1164400578 19:27899561-27899583 ATGTGAGGCCTCCCTGCCTGAGG + Intergenic
1164788427 19:30956305-30956327 AGGAAATGCCACCCTACTTGGGG + Intergenic
1166901952 19:46071348-46071370 CTGAAAGGCCACCCTCTTTCTGG + Intronic
1168574024 19:57493126-57493148 ATGAAAGGCCTCCCTACTTTTGG - Exonic
1168575681 19:57506628-57506650 ATGAAAGGCCTCCCTACTTTTGG - Exonic
926013227 2:9424416-9424438 CTGAAAGGCCACTCTCCTTATGG - Intronic
926554589 2:14342043-14342065 ATGAAAGGACAACCTGCCTGTGG + Intergenic
926787431 2:16531845-16531867 ATGAAAGGACAATCTCCTTGTGG - Intergenic
927707596 2:25306445-25306467 CTGAAAGGCCACTCTCCTGGAGG + Intronic
935077962 2:99764176-99764198 ATGAAAGGCCAGATGCCCTGTGG - Intronic
935588217 2:104821082-104821104 ATGAAAGGTCCCCCTCCATGGGG + Intergenic
939046214 2:137252759-137252781 TGGAAAGGCCAACCTCCCCGTGG - Intronic
941888596 2:170554518-170554540 ATGCCAGGCCACCATTCCTGAGG + Intronic
941925017 2:170885760-170885782 AGGAAATGTCACCTTCCCTGTGG - Intergenic
946669059 2:222082869-222082891 ATGAAGGCACACCCTCCTTGAGG + Intergenic
947458812 2:230283983-230284005 ATGAGAGGACATCCTCCTTGAGG - Intronic
947469053 2:230383148-230383170 ATGAGAGGACATCCTCCTTGAGG - Intronic
948053636 2:234995861-234995883 GTTAGAGGTCACCCTCCCTGGGG + Intronic
1170209997 20:13838785-13838807 AAGACAGGCCTCCCTGCCTGTGG - Intergenic
1171330004 20:24329190-24329212 GTGAAAGGAAACCCTCCCAGTGG - Intergenic
1171997095 20:31739840-31739862 ATCAAACGCCACACTTCCTGAGG - Intronic
1172576255 20:36011028-36011050 ATGGAGGGCTCCCCTCCCTGGGG - Intronic
1173159521 20:40642001-40642023 ACCAAAGTCCACACTCCCTGAGG + Intergenic
1173443066 20:43095214-43095236 ATGAGAGGCCACCCTGCAAGTGG - Intronic
1175083437 20:56439935-56439957 GGGAAAGGCCAAGCTCCCTGAGG + Intronic
1175244864 20:57575945-57575967 GGAAAAGGCCACTCTCCCTGGGG - Intergenic
1175330272 20:58158782-58158804 ATGAGATGCCTCCCTCCCTCTGG + Intronic
1175677930 20:60962618-60962640 GTGAAAGTCCAGCTTCCCTGGGG + Intergenic
1178284839 21:31316877-31316899 ATAACAGGCCTCCCTCCCTGGGG - Intronic
1178436904 21:32567704-32567726 AAGCAGGGCCACCTTCCCTGTGG - Intergenic
1179297114 21:40072876-40072898 ATGAAAGGCCATGTTCTCTGAGG + Intronic
1180836362 22:18931549-18931571 GAGAATGGCCAGCCTCCCTGGGG + Intronic
1181311818 22:21948994-21949016 AGGAGGAGCCACCCTCCCTGAGG - Intronic
1181645965 22:24232035-24232057 AAGGAAGGTCAGCCTCCCTGAGG - Exonic
1183429178 22:37755462-37755484 AGGAAGGGCCACCCTCCCTGGGG + Intronic
1184230749 22:43157188-43157210 ATGAAAGGCCACCCTCCCTGGGG - Intronic
1184853218 22:47132607-47132629 AAGAAAGGCCACTCGCACTGGGG - Intronic
1203286454 22_KI270734v1_random:156848-156870 GAGAATGGCCAGCCTCCCTGGGG + Intergenic
949341177 3:3032703-3032725 CAGAAAGGCCACCCTTCCTGAGG + Intronic
949880533 3:8657474-8657496 CTGACAGGCCACCCTCCATGAGG + Intronic
954430506 3:50468324-50468346 CTGTAAGGCCAGCCTCCCTAGGG + Intronic
955725169 3:61925346-61925368 ATGTAAGGCCAGGCTCCATGAGG - Intronic
955870242 3:63430987-63431009 CTGAAAGGCCACTTTCCCTGTGG - Intronic
960432567 3:117587584-117587606 CAGCAAGGCCACCCTCCCTGGGG + Intergenic
961395267 3:126582870-126582892 AAGGAGGGCCACTCTCCCTGTGG + Intronic
966130153 3:176628254-176628276 ATGAAAGGCTGACCTCTCTGGGG + Intergenic
966208962 3:177433238-177433260 ACGGGAGCCCACCCTCCCTGGGG - Intergenic
968751074 4:2389332-2389354 ATGAGAGGCCAGCCTGCCTGAGG + Intronic
968828112 4:2914572-2914594 AGGAGTGGGCACCCTCCCTGAGG + Intronic
968960680 4:3741821-3741843 AGAAAAGGCCACACTCCCTATGG + Intergenic
970555808 4:17231362-17231384 ATGCCTGGCCTCCCTCCCTGGGG - Intergenic
972399518 4:38687818-38687840 ACTGAAGGCCACCCTCACTGCGG - Intronic
978339414 4:107706843-107706865 ATACCAGGCCAGCCTCCCTGAGG - Intronic
979412271 4:120393803-120393825 ATCAATGGCCACCCTCCCTGAGG + Intergenic
979846096 4:125514068-125514090 ATTAAAGGTCACCCTTTCTGTGG - Intergenic
982173978 4:152688176-152688198 ATGAAAGGCCACCCTTGCAAAGG - Intronic
984782892 4:183541894-183541916 CTGCATGGCCACCCTCCCTGAGG - Intergenic
985516300 5:346663-346685 GTGAAGGGCCGCCGTCCCTGGGG - Intronic
988930719 5:36033429-36033451 ATGAGATGCCATCCACCCTGGGG + Intergenic
989111049 5:37906934-37906956 GAGGAAGGCCACCCTCCATGTGG + Intergenic
989339190 5:40354809-40354831 ATGACAGGACAACCTGCCTGTGG + Intergenic
995444346 5:112226039-112226061 ATGAAAGGCCAGGCCCCATGAGG - Intronic
997786838 5:136721314-136721336 ATGAGAGGCCTCCCTCCATCTGG - Intergenic
998652904 5:144141290-144141312 ATGGAAGCCATCCCTCCCTGTGG + Intergenic
999690804 5:154144398-154144420 ATGAGAGGTCACCTCCCCTGGGG + Intronic
1001137656 5:169115865-169115887 ATGGAAGGCCACCCCCACTTTGG + Intronic
1002937010 6:1682539-1682561 ATGAAAGGCCATCAGCACTGGGG - Intronic
1003667872 6:8128401-8128423 ATCAAAGCCCAGGCTCCCTGTGG + Intergenic
1006837072 6:37005540-37005562 GTGAAAGGTCAGCCCCCCTGAGG + Intergenic
1015075045 6:129146751-129146773 ATTAAAGGCCACTCTTCCTTTGG + Intronic
1017352591 6:153459419-153459441 AAGCAGGGCCACCTTCCCTGTGG - Intergenic
1019477224 7:1249760-1249782 GAGACAGGCCACCCTTCCTGGGG + Intergenic
1020071023 7:5227133-5227155 ATGAAGCTGCACCCTCCCTGGGG - Intronic
1022109620 7:27220446-27220468 GTGAGAGGGCACCATCCCTGGGG + Intergenic
1023355817 7:39366280-39366302 AGCAAAGGACATCCTCCCTGAGG + Intronic
1023553309 7:41391988-41392010 AGGAAAGGCCTCTGTCCCTGGGG - Intergenic
1024065762 7:45733124-45733146 TTGAAAGGCTACCCTTTCTGTGG + Intergenic
1029272962 7:99387938-99387960 CTGAAAGGCCACCATCCAGGTGG - Intronic
1030883661 7:114913156-114913178 TTGAAAGGCCATCCTCCATCTGG + Intergenic
1031938354 7:127760064-127760086 ATGACAGGCTGCCCTCCCTATGG + Intronic
1033163121 7:139014873-139014895 AAGCAAGGTCAGCCTCCCTGAGG - Intergenic
1035454705 7:159000381-159000403 ATGAAATGCCAACATCCATGTGG + Intergenic
1040025156 8:42775107-42775129 GGGCAAGGCCACACTCCCTGTGG + Intronic
1041788899 8:61669088-61669110 GCTAAAGGCCACCCTTCCTGAGG - Intronic
1042606643 8:70552902-70552924 AGGAAAGGGCACCCTGTCTGGGG + Intergenic
1042979926 8:74514948-74514970 ATGAAAGACCTTCCTCTCTGGGG - Intergenic
1043737694 8:83768442-83768464 ATGACAGGACAACCTGCCTGTGG - Intergenic
1044300813 8:90580953-90580975 TTGACAGGCTACCCTCCCTCTGG + Intergenic
1046706634 8:117460744-117460766 AAGCAAAGCCACACTCCCTGTGG - Intergenic
1048537462 8:135310917-135310939 ATGAAATGACACCATCCCTTAGG + Intergenic
1049533028 8:143165823-143165845 ATGAAAGACTGGCCTCCCTGCGG + Intergenic
1053334387 9:37251673-37251695 ATAAAAGGCCAGCCTGCCTGTGG - Intronic
1053787776 9:41664571-41664593 GGGAACGGCCACCCTCCATGAGG - Intergenic
1054157350 9:61650196-61650218 GGGAACGGCCACCCTCCATGAGG + Intergenic
1054176052 9:61875913-61875935 GGGAACGGCCACCCTCCATGAGG - Intergenic
1054477124 9:65581201-65581223 GGGAACGGCCACCCTCCATGAGG + Intergenic
1054661487 9:67704895-67704917 GGGAACGGCCACCCTCCATGAGG + Intergenic
1060400439 9:123345790-123345812 ATGAAAGCCAGGCCTCCCTGAGG + Intergenic
1060732290 9:126046412-126046434 CTGCAGGGCCAGCCTCCCTGTGG - Intergenic
1062450041 9:136611328-136611350 ATGAGTGGCCACCCAGCCTGTGG - Intergenic
1185496458 X:557804-557826 ATGGGAGGCCACCCTCTTTGTGG + Intergenic
1187790790 X:22947849-22947871 ATGACAGGCCACCCTTTCTGTGG + Intergenic
1187801637 X:23069930-23069952 AGGAAAACCCACCCTCACTGTGG - Intergenic
1188041299 X:25372428-25372450 ATCAAAGGACACCCAACCTGTGG - Intergenic
1192005461 X:67207297-67207319 ATAAAATGGCACCCTCCATGAGG + Intergenic
1193659107 X:84235883-84235905 ATGAAGGGCCAGCTTCTCTGTGG - Intergenic
1194503764 X:94708284-94708306 AGGTACGGCCACCCTACCTGTGG + Intergenic
1195917640 X:109951698-109951720 CTTAAAGGCCTCCCTTCCTGTGG - Intergenic
1197177619 X:123502073-123502095 AAGCAAGGTCACACTCCCTGGGG + Intergenic
1197378452 X:125710183-125710205 TTGACAGGACACCCTGCCTGTGG + Intergenic
1201559829 Y:15304129-15304151 ATCAAATGCCTCCTTCCCTGGGG - Intergenic