ID: 1184230750

View in Genome Browser
Species Human (GRCh38)
Location 22:43157189-43157211
Sequence TATGAAAGGCCACCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230750_1184230761 29 Left 1184230750 22:43157189-43157211 CCCAGGGAGGGTGGCCTTTCATA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230750 Original CRISPR TATGAAAGGCCACCCTCCCT GGG (reversed) Intronic
903357926 1:22759461-22759483 AATGAAATCCCACCATCCCTTGG - Intronic
903728418 1:25470512-25470534 CATGAAAGGCCACCTGCCCCTGG - Intronic
906225015 1:44114487-44114509 TACTATAGGCCACTCTCCCTTGG - Intergenic
910282470 1:85516518-85516540 GATTAAATGCCACCCACCCTGGG - Intronic
911050309 1:93665286-93665308 TTTTCAGGGCCACCCTCCCTGGG - Intronic
919726766 1:200889765-200889787 TAGAAAAAGCCACCCTCTCTAGG + Intergenic
1066242890 10:33555168-33555190 TATGAAAAGCCACACTTCTTTGG - Intergenic
1068217475 10:54001016-54001038 TATGACATGCCACTCTCTCTTGG - Intronic
1069606753 10:69743694-69743716 CAGGAGGGGCCACCCTCCCTTGG - Intergenic
1077387361 11:2276548-2276570 TATGAAGGGCCACCCCTCCCAGG + Intergenic
1081941673 11:46948063-46948085 TATGAAAGGCCACACGTCTTCGG + Intronic
1083379045 11:62249452-62249474 TCTGAAAGCCCACACTACCTAGG + Intergenic
1087178441 11:95118472-95118494 TATGGAATGCCACTCTCCCCTGG + Intronic
1089987136 11:122825165-122825187 TAGGAAAGGCAGCCTTCCCTTGG + Intergenic
1091945563 12:4538374-4538396 TCTGAAAGGGCATCCTCACTCGG + Intronic
1092836999 12:12500011-12500033 TATGCACTGCCAGCCTCCCTGGG - Intronic
1093358331 12:18196490-18196512 TATGGAAGGCAGCCTTCCCTTGG + Intronic
1094377126 12:29802043-29802065 TTTTAAAGGCCCCCCTCCCCCGG + Intergenic
1095943936 12:47743483-47743505 TCCGAGGGGCCACCCTCCCTTGG + Intronic
1095990134 12:48028842-48028864 TATGAAAGGCCTTCCTTTCTGGG + Intergenic
1097791442 12:63819491-63819513 TATGTCATGCCACTCTCCCTTGG - Intergenic
1103916690 12:124379434-124379456 TGTGAAAGGCCAGCCTTCGTGGG + Intronic
1104837855 12:131803418-131803440 GATGCAACCCCACCCTCCCTGGG + Intergenic
1113661120 13:112106949-112106971 TGCGAAAGACCCCCCTCCCTGGG - Intergenic
1121626125 14:95386647-95386669 TCTGAAAAGCCCCCCACCCTGGG + Intergenic
1122112579 14:99512716-99512738 TCTGAAAGGGCACCCCCACTGGG + Exonic
1125511773 15:40296072-40296094 TATGACAGGCCACCTTGGCTGGG - Intronic
1126764004 15:51995531-51995553 TATGATAGGCCTCTCTCCCTGGG + Intronic
1127328407 15:57916813-57916835 TATTAAACTCCACCCGCCCTGGG + Intergenic
1127653504 15:61033105-61033127 TATAAAAGTCCACGCTCTCTTGG + Intronic
1128714800 15:69900414-69900436 TAAGCAAGGCCTTCCTCCCTGGG - Intergenic
1143345355 17:6245103-6245125 TGTGAAATGCCAGTCTCCCTGGG + Intergenic
1143654430 17:8285651-8285673 GGTGGAAGGCCACCCTCACTTGG - Intergenic
1146457772 17:33020671-33020693 AATGAAGGGCCACTCTCCCCAGG - Intronic
1147889592 17:43707962-43707984 TAAGACAAGCCACACTCCCTAGG + Intergenic
1148127726 17:45245524-45245546 AATGAGGGGCCACCCTGCCTGGG + Intronic
1149869816 17:60171344-60171366 AATGAAAGGCCACAGGCCCTGGG + Intergenic
1151194133 17:72420035-72420057 CCTGTAAAGCCACCCTCCCTGGG + Intergenic
1151944328 17:77311249-77311271 TCAGCAAGGCCACACTCCCTAGG - Intronic
1152068478 17:78124061-78124083 TAGGGCAGGCCACCCACCCTGGG + Exonic
1152484436 17:80580921-80580943 TATGAAAGGCCACACAGGCTAGG - Intronic
1153121223 18:1729668-1729690 CATCAAAGGCAACCCTCCCAAGG - Intergenic
1153323301 18:3793811-3793833 TACGAAAGGCCACACTCACAAGG - Intronic
1153571309 18:6475944-6475966 TAAGATTGCCCACCCTCCCTAGG - Intergenic
1156600841 18:38604224-38604246 TTTGAATGGCCACACTCACTAGG + Intergenic
1161289706 19:3486724-3486746 TATAAAAAGCCACCCTCACCGGG - Intergenic
1161630363 19:5351882-5351904 TATGAAAGCCCATGCTGCCTGGG - Intergenic
1162099596 19:8331822-8331844 TTGGCAAGGCCTCCCTCCCTGGG - Intronic
1163501931 19:17681307-17681329 TCTGAAAGCCCACCCGCCCCAGG + Intronic
1166209972 19:41300188-41300210 GTTGAAAAGCCTCCCTCCCTGGG - Intronic
1167550859 19:50159778-50159800 TAGGCAAAGCCACCCTTCCTTGG + Intronic
928827853 2:35441833-35441855 TAGGAAAGGCAGCCTTCCCTTGG - Intergenic
929941350 2:46336350-46336372 TATTAAAGGCCTCCCTGTCTTGG - Intronic
932347068 2:71002356-71002378 GATGAAAGTCCAGCCTCCCTGGG + Intergenic
932771932 2:74505315-74505337 TAAGCCAGGCCACCCTCCCTGGG - Intronic
935588216 2:104821081-104821103 GATGAAAGGTCCCCCTCCATGGG + Intergenic
936825211 2:116574249-116574271 TATGTCATGCCACCCTCTCTTGG + Intergenic
943551379 2:189344738-189344760 TATCAAAGGCTACTCTTCCTAGG + Intergenic
945006899 2:205418036-205418058 TATGAAAGGTCACCTTTACTTGG + Intronic
948580085 2:238981124-238981146 TATCAAAGGCACCCTTCCCTAGG - Intergenic
949039988 2:241843796-241843818 TCTGAAAGGGAACCCACCCTCGG - Intergenic
1170376814 20:15709151-15709173 CATGGAAAGCCAGCCTCCCTAGG - Intronic
1171412328 20:24955919-24955941 GATGGAAGGCCAGGCTCCCTGGG + Intronic
1172409210 20:34709645-34709667 TCTCAAAGGCAACCCTCCCAAGG - Intronic
1173168839 20:40706070-40706092 GATGGATGACCACCCTCCCTTGG + Intergenic
1175244865 20:57575946-57575968 TGGAAAAGGCCACTCTCCCTGGG - Intergenic
1177010750 21:15728644-15728666 TTTGACAGGTCACCCTCCTTGGG + Intergenic
1178284840 21:31316878-31316900 GATAACAGGCCTCCCTCCCTGGG - Intronic
1179352321 21:40623921-40623943 TCTGAAAGGGGCCCCTCCCTTGG - Intronic
1180501886 22:15937103-15937125 TAAGACAGGCCATCATCCCTAGG + Intergenic
1182930636 22:34170764-34170786 TATGGAAGGACACCCTCTTTCGG - Intergenic
1183429177 22:37755461-37755483 AAGGAAGGGCCACCCTCCCTGGG + Intronic
1184230750 22:43157189-43157211 TATGAAAGGCCACCCTCCCTGGG - Intronic
1184639984 22:45865617-45865639 CATGAAAGGCCACCATGCCAGGG + Intergenic
953393420 3:42547556-42547578 TGCTAAAGGCCACCTTCCCTTGG + Intergenic
954096230 3:48330962-48330984 CATCAAAGGCACCCCTCCCTAGG - Intergenic
954430505 3:50468323-50468345 GCTGTAAGGCCAGCCTCCCTAGG + Intronic
954673353 3:52302522-52302544 TCTGAAAGGCCACAGGCCCTGGG + Intergenic
960432566 3:117587583-117587605 CCAGCAAGGCCACCCTCCCTGGG + Intergenic
963809039 3:149756898-149756920 CATCAAAGGCAACCCTCCCAAGG - Intergenic
966130152 3:176628253-176628275 TATGAAAGGCTGACCTCTCTGGG + Intergenic
966208963 3:177433239-177433261 TACGGGAGCCCACCCTCCCTGGG - Intergenic
967151868 3:186658505-186658527 TAAGAAAGGCAGCCTTCCCTTGG + Intergenic
976618215 4:87099895-87099917 TATCAAATGTCACCCTCTCTGGG - Intronic
979054860 4:115980527-115980549 TAGGAAAGGCAGCCTTCCCTTGG - Intergenic
982549455 4:156779374-156779396 TATAATTGGCCACCTTCCCTAGG - Intronic
982642444 4:157980204-157980226 TCTGAGAAGCCACCATCCCTGGG + Intergenic
983181906 4:164657707-164657729 CATCAAAGGCACCCCTCCCTAGG + Intergenic
984824159 4:183908982-183909004 AATGATAAGCCTCCCTCCCTGGG - Intronic
988517332 5:31916355-31916377 TACGCAAGGGCACCCTCCCCTGG - Intronic
994951051 5:106463308-106463330 TGTGAAAAGCCACTTTCCCTAGG - Intergenic
996277227 5:121681585-121681607 TGTGAAATGCCAACCTTCCTCGG + Intergenic
998928442 5:147154133-147154155 TATTTAAGGCCACCTCCCCTTGG + Intergenic
999631177 5:153572971-153572993 TCTGAAAGGCCAGACTCTCTGGG - Intronic
1000018808 5:157301501-157301523 GATCAAAGGCAATCCTCCCTGGG - Intronic
1001310582 5:170607433-170607455 TAGGAAAGGCCCCCAGCCCTGGG - Intronic
1001884517 5:175277414-175277436 AACTAAAGGCCACCATCCCTGGG + Intergenic
1004225889 6:13784074-13784096 TCCCAAAGGCCACCCTCCTTGGG + Intergenic
1005196804 6:23296698-23296720 TATGAATGGCCAGCCTCCACTGG - Intergenic
1005249102 6:23924057-23924079 TATGAAGGGTCATCCACCCTTGG - Intergenic
1011248921 6:85349778-85349800 TAGGCAGGGCCACACTCCCTCGG + Intergenic
1013543975 6:111137614-111137636 TATCAAAGGCACCCCTCCCGAGG + Intronic
1014284764 6:119484500-119484522 CATGAAAGTCCACAATCCCTGGG - Intergenic
1018521781 6:164657298-164657320 TAGGAAAGGCAGCCTTCCCTTGG - Intergenic
1022493066 7:30835652-30835674 TATCAAAGGCCACCATTCCCAGG - Intronic
1029915885 7:104209113-104209135 TATCAGAGGCCAGCTTCCCTTGG - Intergenic
1031135092 7:117875353-117875375 TATGAAATGACACCATCTCTGGG + Intergenic
1031685623 7:124729889-124729911 TAGGGAAGGCAACCTTCCCTTGG + Intergenic
1034285841 7:149882466-149882488 TGAGAAAGGCCACCCTGCCTGGG - Intergenic
1035587524 8:787389-787411 TTTTAGAGGCCACCCTTCCTCGG - Intergenic
1037023034 8:13997813-13997835 TATATTAAGCCACCCTCCCTAGG + Intergenic
1038022710 8:23563564-23563586 GATGCAGGGCTACCCTCCCTGGG + Intronic
1040533114 8:48282172-48282194 GAGAAAAGGCCACCCTCTCTTGG + Intergenic
1042979927 8:74514949-74514971 TATGAAAGACCTTCCTCTCTGGG - Intergenic
1044491099 8:92815809-92815831 TATGGAAGAAGACCCTCCCTGGG - Intergenic
1045760374 8:105599155-105599177 CTTGAAATGCCACTCTCCCTGGG + Intronic
1046821808 8:118642135-118642157 TGGTAAAGGCAACCCTCCCTAGG + Intergenic
1058717872 9:107738669-107738691 TCTGCCAGGCCATCCTCCCTCGG - Intergenic
1060436113 9:123594622-123594644 TAGGAAAGTCTCCCCTCCCTGGG - Intronic
1185481857 X:452125-452147 TTTGAAATGCCAGCTTCCCTTGG - Intergenic
1186190214 X:7060859-7060881 TCTGTGAGGGCACCCTCCCTAGG + Intronic
1188418659 X:29970103-29970125 TAGGAATGACCACTCTCCCTTGG + Intergenic
1189122056 X:38405348-38405370 GTTGACAGGCCACACTCCCTCGG + Intronic
1189222815 X:39387108-39387130 TGTGAAAGGCAACCCTCTTTAGG + Intergenic
1191978933 X:66904222-66904244 TATGGAAGGCCATCCTTTCTTGG + Intergenic
1197177618 X:123502072-123502094 TAAGCAAGGTCACACTCCCTGGG + Intergenic
1199715898 X:150507168-150507190 TATAAAAGGCCACACGGCCTAGG + Intronic
1199722658 X:150553259-150553281 TTGGCAAGGCCACGCTCCCTTGG - Intergenic
1201723904 Y:17133551-17133573 CATCAAAGGCAACCCTCCCAAGG - Intergenic