ID: 1184230751

View in Genome Browser
Species Human (GRCh38)
Location 22:43157190-43157212
Sequence ATATGAAAGGCCACCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230751_1184230761 28 Left 1184230751 22:43157190-43157212 CCAGGGAGGGTGGCCTTTCATAT 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230751 Original CRISPR ATATGAAAGGCCACCCTCCC TGG (reversed) Intronic
905236842 1:36555896-36555918 CTCTGAAACTCCACCCTCCCAGG + Intergenic
905944395 1:41889633-41889655 AAATGAAGGCCCACCCTGCCGGG - Intronic
907270152 1:53286379-53286401 ATCAGAGAGGCCCCCCTCCCAGG + Intronic
909807205 1:79886289-79886311 AAATGAAAATACACCCTCCCAGG + Intergenic
910280134 1:85490822-85490844 TTATGATAGGCCTCCCTTCCTGG + Intronic
914444559 1:147739011-147739033 ATAAGAAATGCCACCCTGACAGG - Intergenic
917180425 1:172290763-172290785 ATATGAAAGGCCACCATACTGGG + Intronic
922337363 1:224628685-224628707 ATCTGAATGGGCTCCCTCCCTGG + Intronic
923519230 1:234723147-234723169 ATAAGAAGGGGCACCCTCCGCGG + Intergenic
1070717396 10:78732625-78732647 ATCTGAAAGGTCAACATCCCCGG + Intergenic
1070904047 10:80056017-80056039 ATAGGAATGGCCTCCATCCCAGG - Intergenic
1073539715 10:104308144-104308166 AGATGCAAGGCCATCGTCCCAGG + Intergenic
1074221609 10:111443696-111443718 CTATCAAAGGCCACCCAACCGGG - Intergenic
1078544858 11:12240108-12240130 GTATTGAAGGCCAACCTCCCAGG + Intronic
1084923704 11:72494663-72494685 ATACCGAAGGCCGCCCTCCCAGG + Intergenic
1089206897 11:116771904-116771926 GTCTGCAAGGCCATCCTCCCTGG + Intronic
1092055680 12:5506423-5506445 CTATGAAAGGCCACTCTCCCGGG - Intronic
1098583196 12:72126014-72126036 ATACTCAAGGACACCCTCCCAGG - Intronic
1104837854 12:131803417-131803439 AGATGCAACCCCACCCTCCCTGG + Intergenic
1115987464 14:39116563-39116585 ATTTAAAATGCCACTCTCCCAGG - Intronic
1119145867 14:72313489-72313511 AAATGCAAGCCCCCCCTCCCAGG - Intronic
1120016763 14:79482739-79482761 AAATGAAAACCCACCCTCTCTGG + Intronic
1122112578 14:99512715-99512737 ATCTGAAAGGGCACCCCCACTGG + Exonic
1126764003 15:51995530-51995552 TTATGATAGGCCTCTCTCCCTGG + Intronic
1127328406 15:57916812-57916834 ATATTAAACTCCACCCGCCCTGG + Intergenic
1132881129 16:2162184-2162206 ACCTGGAAGGCCACCCACCCTGG - Intronic
1137575407 16:49596765-49596787 GCATGCAAGGCCACCTTCCCGGG - Intronic
1140448978 16:75054745-75054767 ATAGGTAAGGCCAATCTCCCAGG - Intronic
1142780566 17:2178298-2178320 GTATCAAAGGCCACCATTCCAGG + Intronic
1148835704 17:50464718-50464740 ATCAGGATGGCCACCCTCCCAGG - Exonic
1151634008 17:75331413-75331435 ATAGGAAAGGCTACCTTCCTTGG - Intronic
1152823683 17:82450336-82450358 ATATGACTGGGCTCCCTCCCGGG + Intronic
1152922726 17:83073871-83073893 ATCTGGACGTCCACCCTCCCCGG + Intergenic
1157130593 18:45003821-45003843 ATAAGAAATGTCACCCTTCCTGG - Intronic
1157499332 18:48178967-48178989 ATATGAGAAGCCACACTCCTGGG - Intronic
1161289707 19:3486725-3486747 ATATAAAAAGCCACCCTCACCGG - Intergenic
1161473361 19:4472391-4472413 AGATGAAGGGCTACCCTCACTGG + Exonic
928525067 2:32131626-32131648 TAATGAAAGGCCACACTCACTGG - Intronic
929982893 2:46698431-46698453 ATATGGAAGGGCCCCCTCCCTGG - Intergenic
930112217 2:47688353-47688375 ATATAAAAAGCCACCACCCCAGG + Intergenic
931231118 2:60375691-60375713 ATCTGAAAGGACACCCTCTGAGG - Intergenic
931442171 2:62297806-62297828 CTCTGGAATGCCACCCTCCCAGG - Intergenic
931600356 2:63996684-63996706 ATTTTAGAGGCCCCCCTCCCCGG - Intronic
932347067 2:71002355-71002377 TGATGAAAGTCCAGCCTCCCTGG + Intergenic
932361437 2:71110883-71110905 ATATGAATGGCCACATTCCTAGG + Intronic
932771933 2:74505316-74505338 GTAAGCCAGGCCACCCTCCCTGG - Intronic
934988554 2:98904559-98904581 ATATGAATGCCCAGCCTTCCAGG + Intronic
937321021 2:120960830-120960852 TGATGAAAACCCACCCTCCCTGG + Intronic
938783416 2:134605424-134605446 ATATTACAGGCTACCCTGCCTGG - Intronic
939956350 2:148530624-148530646 ATACGAAAGGTCTCCATCCCAGG - Intergenic
1178032519 21:28544154-28544176 ACATAAAGGGCCACCCTTCCAGG - Intergenic
1180069498 21:45429298-45429320 AGATGAAAGGCCAGAGTCCCAGG + Intronic
1180663852 22:17493827-17493849 ATAAGAAAGGTCTCGCTCCCTGG + Intronic
1183429176 22:37755460-37755482 GAAGGAAGGGCCACCCTCCCTGG + Intronic
1184230751 22:43157190-43157212 ATATGAAAGGCCACCCTCCCTGG - Intronic
1184639983 22:45865616-45865638 CCATGAAAGGCCACCATGCCAGG + Intergenic
950587005 3:13900052-13900074 AGATGAAAGGATACCCACCCAGG + Intergenic
954430280 3:50467156-50467178 CTAGGAATGGCCAGCCTCCCTGG + Intronic
955924846 3:63994818-63994840 AAATAAAAGGAGACCCTCCCTGG + Intronic
961661065 3:128469087-128469109 AGATGAAAGGGCAGCCTGCCTGG + Intergenic
966208964 3:177433240-177433262 ATACGGGAGCCCACCCTCCCTGG - Intergenic
967710181 3:192697608-192697630 ATATGCAAGGCAACACTCCTGGG - Intronic
967748670 3:193088272-193088294 ATATGAAAGGTCAGAGTCCCAGG + Intergenic
982783848 4:159520252-159520274 TTGTCAAAGGCCACCCTCCAGGG + Intergenic
984824160 4:183908983-183909005 AAATGATAAGCCTCCCTCCCTGG - Intronic
987113462 5:14708522-14708544 AGGAGAAAGGTCACCCTCCCTGG + Exonic
988808402 5:34761696-34761718 ATCCAAAATGCCACCCTCCCTGG + Intronic
991107275 5:62859317-62859339 ATATGTCATGCCACTCTCCCTGG + Intergenic
997756794 5:136407100-136407122 ATCTGAATGGACACCCTCCTTGG - Intergenic
999631178 5:153572972-153572994 ATCTGAAAGGCCAGACTCTCTGG - Intronic
1002088620 5:176791616-176791638 ATCTGGAAGGCCACCCCTCCAGG + Intergenic
1008856777 6:56097559-56097581 ATCTAAAGGGCCACACTCCCTGG + Intronic
1011734576 6:90297568-90297590 ACATTAAAAGCCAACCTCCCGGG + Intergenic
1014284765 6:119484501-119484523 ACATGAAAGTCCACAATCCCTGG - Intergenic
1019887671 7:3919519-3919541 AACTGAAAGAGCACCCTCCCTGG + Intronic
1028515835 7:91677566-91677588 TTATGGAAGGCCAGCCTCCCAGG + Intergenic
1028834561 7:95359849-95359871 ATAAGAAAAGCCACACTCACTGG + Intergenic
1031135091 7:117875352-117875374 ATATGAAATGACACCATCTCTGG + Intergenic
1032532948 7:132636957-132636979 ATATGCACGTCCTCCCTCCCAGG + Intronic
1033274275 7:139959550-139959572 AGAGGAAAGGCCACTCTCCAGGG - Intronic
1034285842 7:149882467-149882489 GTGAGAAAGGCCACCCTGCCTGG - Intergenic
1044616322 8:94146097-94146119 ATGTGAATGACAACCCTCCCAGG - Exonic
1061935945 9:133857739-133857761 AGGTGACAGGCAACCCTCCCAGG - Intronic
1190723465 X:53171096-53171118 ATGGGAAGGGCCACCCGCCCAGG - Intergenic
1197177617 X:123502071-123502093 ATAAGCAAGGTCACACTCCCTGG + Intergenic
1200335448 X:155346539-155346561 ATATAATAGTCCATCCTCCCAGG - Intergenic
1200351020 X:155494682-155494704 ATATAATAGTCCATCCTCCCAGG + Intronic