ID: 1184230752

View in Genome Browser
Species Human (GRCh38)
Location 22:43157203-43157225
Sequence GATGTCACTACACATATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230752_1184230766 26 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230766 22:43157252-43157274 CGTGTACCCTGGAAGCTGGAGGG 0: 1
1: 0
2: 3
3: 7
4: 113
1184230752_1184230761 15 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1184230752_1184230764 22 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230764 22:43157248-43157270 AGCACGTGTACCCTGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 158
1184230752_1184230768 30 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230768 22:43157256-43157278 TACCCTGGAAGCTGGAGGGCGGG 0: 1
1: 1
2: 5
3: 31
4: 325
1184230752_1184230765 25 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230765 22:43157251-43157273 ACGTGTACCCTGGAAGCTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 154
1184230752_1184230767 29 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230767 22:43157255-43157277 GTACCCTGGAAGCTGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230752 Original CRISPR GATGTCACTACACATATGAA AGG (reversed) Intronic
906631078 1:47368973-47368995 TTTTTCATTACACATATGAAAGG - Intronic
907193109 1:52665098-52665120 GATGTCTGTACAGATGTGAAAGG + Intronic
907331009 1:53671571-53671593 GATTTCACTAAATATAAGAACGG + Intronic
908542497 1:65135185-65135207 GATTTCATTACACACATTAAAGG + Intergenic
910114316 1:83715581-83715603 GATGTAAATATATATATGAAAGG - Intergenic
911168458 1:94745798-94745820 GATGTCATTAGACAGATGAAGGG + Intergenic
914490512 1:148148005-148148027 GATGTCACCACTCAAACGAACGG - Intronic
917410504 1:174755869-174755891 CATGTCACTAAACACATGTAAGG + Intronic
918805631 1:189038487-189038509 GATATCACTTCAAATATTAAGGG - Intergenic
920963804 1:210685964-210685986 GAGGTCACTACACAGGTGGATGG + Intronic
921270546 1:213465478-213465500 GATGTCAATACACAGCTGATTGG - Intergenic
924319441 1:242833172-242833194 GAAGTCACAACACATCTTAAAGG + Intergenic
1063354105 10:5381993-5382015 GTTGTCCCTACACAGATGCACGG - Intergenic
1063898524 10:10707447-10707469 GTTGTCACTAAATATTTGAATGG + Intergenic
1067003767 10:42641699-42641721 GATGTCCATACACATACGGAGGG + Intergenic
1067995123 10:51263481-51263503 GATGCTACCACAGATATGAATGG - Intronic
1068422325 10:56810480-56810502 GATGTTGCTACACATTTCAAAGG + Intergenic
1070266806 10:74910779-74910801 GATGTCACCACTCATTTTAATGG + Intronic
1071934942 10:90518990-90519012 GGTGTCACTGCACATAAGATCGG + Intergenic
1072857061 10:98959073-98959095 GAAGGCACTACAAATATGAAAGG + Intronic
1077039932 11:515902-515924 GACGGGGCTACACATATGAATGG - Intergenic
1078496897 11:11826371-11826393 GATGTCAATCCACACATAAAAGG - Intergenic
1079823706 11:25163878-25163900 GTTGGCATTACACAGATGAAGGG - Intergenic
1081923671 11:46803813-46803835 GATTTCAATACAGAAATGAATGG - Intronic
1084228804 11:67735307-67735329 GATATCACGACTCATATCAAGGG - Intergenic
1084846465 11:71904386-71904408 GATATCACGACTCATATCAAGGG + Intronic
1085498938 11:76999847-76999869 GATGTTACTCAACAGATGAATGG - Intronic
1087861922 11:103168629-103168651 AATTTCATGACACATATGAATGG - Intronic
1096801935 12:54116213-54116235 GAGGTCACTGCACATCTGAGTGG - Intergenic
1103462108 12:121113156-121113178 GATGTCCCTAAACAGACGAATGG + Intergenic
1104209742 12:126677341-126677363 GATGACATTATACACATGAAAGG + Intergenic
1108965547 13:56295070-56295092 ATTGTCACTACAAATATGGATGG - Intergenic
1109217595 13:59607509-59607531 GATGTCACTATAATTCTGAAAGG - Intergenic
1110083578 13:71347632-71347654 GATTTCACTATATATAAGAATGG - Intergenic
1115150668 14:30281427-30281449 GATGGCTCTACCCTTATGAATGG - Intergenic
1115159096 14:30373105-30373127 GATGTCACTCTACTTTTGAATGG + Intergenic
1116334035 14:43634374-43634396 GAGGGCACTGCCCATATGAAGGG - Intergenic
1117971572 14:61255971-61255993 GATGTCAGTCTACACATGAAAGG + Intronic
1118127502 14:62924268-62924290 GATGTCACCTCACACATGATAGG + Intronic
1118626743 14:67666304-67666326 AATGTAACTACATAAATGAAAGG + Intronic
1119370896 14:74141677-74141699 CATATCACTACACATATGTCCGG - Intronic
1119967506 14:78933232-78933254 GAGGTCAGTACATATTTGAATGG + Intronic
1122181854 14:99961008-99961030 GATGTCCCTCAACAGATGAATGG - Intergenic
1123921160 15:25070812-25070834 GATGTCACTGCACACAGGACTGG + Intergenic
1128613292 15:69090543-69090565 GATGTCATTACACATGGGATGGG - Intergenic
1128734509 15:70045311-70045333 GATGTCTCTTCAAATATAAAAGG + Intergenic
1129946901 15:79546467-79546489 GATGTCATTACAGATATTATCGG + Intergenic
1130078764 15:80712656-80712678 GCTGTCAATCCACATATGGAGGG - Intronic
1135228143 16:20679547-20679569 GCTTACACTACACATAGGAATGG - Intronic
1135494878 16:22942684-22942706 GAAGGCACCACACAGATGAATGG - Intergenic
1143564420 17:7712775-7712797 CAAGTCACTACACATGTGAAAGG - Intergenic
1144517843 17:15931363-15931385 GATCTCACTTCACACATGAGTGG - Intergenic
1144649650 17:16999272-16999294 GATGTCCCTCCACGGATGAATGG - Intergenic
1149935354 17:60799974-60799996 GATGTCCCTCAACAGATGAATGG - Intronic
1151988817 17:77560988-77561010 GATGCCACTAGCCATGTGAAGGG - Intergenic
1158106139 18:53887175-53887197 TATGTCACTATACATCAGAAAGG - Intergenic
1158312795 18:56176999-56177021 GATTCCAATACAAATATGAATGG + Intergenic
1158370836 18:56801841-56801863 GATGTCCCTAAACAGGTGAATGG - Intronic
1160270786 18:77381770-77381792 GCTGTCAAAACACATATGTATGG - Intergenic
925488959 2:4370340-4370362 GATCTCAAATCACATATGAAAGG - Intergenic
926667093 2:15537436-15537458 GATGTGACTAGACAAAGGAAAGG - Intronic
927063874 2:19449903-19449925 GATGTTACTACTAATCTGAAAGG + Intergenic
927369771 2:22340969-22340991 GGTTTCACTATAAATATGAAAGG + Intergenic
928681197 2:33704034-33704056 AATGTCAATAAACACATGAAAGG + Intergenic
929065152 2:37965226-37965248 GAAGTCATTACAGATAGGAAAGG + Intronic
931183976 2:59931735-59931757 GAATTCACTAGACAAATGAAAGG + Intergenic
933569619 2:83994096-83994118 GATGAAACTACACATAAGGAAGG - Intergenic
934506880 2:94901975-94901997 GATGTCACTACACATATCGCAGG - Intergenic
935604036 2:104951889-104951911 AATGTCCATACACAGATGAATGG - Intergenic
941103661 2:161326654-161326676 GATGTCCCTCAACAAATGAATGG + Intronic
942440841 2:176034736-176034758 GATGCCACTGCACGTGTGAAAGG - Intergenic
943672075 2:190673611-190673633 GATGTAAATACAACTATGAAAGG - Intronic
943823121 2:192352904-192352926 GAGGTCATTCCACAGATGAATGG - Intergenic
946954937 2:224919280-224919302 TATGTCTGTACACATGTGAATGG + Intronic
948898698 2:240944419-240944441 GCTGTAATTACACATATGATGGG + Intronic
1169831146 20:9826784-9826806 GCTTTCACTACACAAATCAAGGG + Intronic
1171794775 20:29558252-29558274 GAGGTCACTGCACATTTGAGTGG + Intergenic
1171853681 20:30326013-30326035 GAGGTCACTGCACATTTGAGTGG - Intergenic
1175504117 20:59469925-59469947 GATGCCACAACACAAAAGAAGGG - Intergenic
1175959630 20:62628928-62628950 GATGCCACGACACATAGAAAGGG - Intergenic
1176607378 21:8844280-8844302 GAAGTCACTACACATATCGCAGG + Intergenic
1180357460 22:11854067-11854089 GAAGTCACTACACATATCGCAGG + Intergenic
1180380807 22:12138264-12138286 GAAGTCACTACACATATCGCAGG - Intergenic
1181121165 22:20669354-20669376 GATGTCACCACTCAAAGGAACGG + Intergenic
1181334125 22:22116380-22116402 GATGTCACCACTCAAACGAACGG + Intergenic
1184230752 22:43157203-43157225 GATGTCACTACACATATGAAAGG - Intronic
952361481 3:32634567-32634589 GACATCACTACAGATATGATGGG - Intergenic
955741129 3:62092819-62092841 TTTATCACTACACATATGACAGG - Intronic
955947506 3:64209506-64209528 GATGTATTTACAGATATGAATGG - Intronic
956919282 3:73909247-73909269 CATGCTACTACATATATGAAGGG + Intergenic
957045395 3:75370124-75370146 GATATCACGACTCATATCAAGGG - Intergenic
958506304 3:94982544-94982566 GATGTCCTTCCACAGATGAATGG - Intergenic
958602281 3:96311942-96311964 GATGCTACCACAAATATGAAGGG - Intergenic
958896799 3:99838487-99838509 AATGTCCCTAAACATATGCAGGG - Intronic
960497248 3:118389369-118389391 GATGTAAGTGCACATAAGAATGG + Intergenic
964175419 3:153821909-153821931 GCAGCCACTACACATGTGAATGG + Intergenic
964272803 3:154976889-154976911 ATTGTATCTACACATATGAAAGG + Intergenic
964952278 3:162310688-162310710 GATGTCACAACACAAAGTAAAGG - Intergenic
966003935 3:174985080-174985102 GATGTCAGGACACATCTGTATGG - Intronic
966367809 3:179209352-179209374 GATATCACTATACATAAGAATGG - Intronic
966585688 3:181621381-181621403 GATGTCCTGACACAGATGAATGG + Intergenic
967292211 3:187932338-187932360 AATGTGAAAACACATATGAAAGG - Intergenic
968989669 4:3901281-3901303 GATATCACGACTCATATCAAGGG - Intergenic
969787461 4:9470246-9470268 GATATCACGACTCATATCAAGGG + Intergenic
969934150 4:10664833-10664855 GCTGGCACCACACAAATGAAAGG - Intronic
972899834 4:43669399-43669421 GAAGTCACAACACACAGGAAGGG - Intergenic
973370741 4:49246933-49246955 GAAGTCACTACACATATCGCAGG - Intergenic
974192323 4:58522054-58522076 GATGTCACTATATAAATAAATGG - Intergenic
978312884 4:107405217-107405239 GATGTCATAACACATAGGCAAGG + Intergenic
980220790 4:129911083-129911105 GAGGGCACTACACATTTGTATGG + Intergenic
980223887 4:129956026-129956048 AATGTCCTTCCACATATGAAGGG + Intergenic
980662542 4:135882688-135882710 TAAGTTACTACACATAAGAAGGG + Intergenic
982322175 4:154088496-154088518 GAAGTCACTTGACATATTAATGG + Intergenic
984631720 4:182067711-182067733 GGAGTCCCTCCACATATGAAGGG - Intergenic
986320863 5:6632238-6632260 GATGTAACTACAAAGATGGAGGG + Intronic
987913314 5:24179032-24179054 GATGTCACTTCACATTTGTTAGG - Intergenic
989555284 5:42787836-42787858 GGTGTCATTACACATAGGATGGG + Intronic
992326585 5:75665922-75665944 GAAGTCACTATACATGAGAAAGG + Intronic
998249296 5:140540193-140540215 GATGACACTAAACAAATGTAGGG + Intronic
999212102 5:149898720-149898742 GAAGTTATTACACATAAGAATGG - Intronic
1000773990 5:165394164-165394186 GATGTCCATCCACAGATGAATGG + Intergenic
1000870265 5:166568411-166568433 GACCTCACTACAGACATGAAAGG + Intergenic
1000922108 5:167150452-167150474 GATTTCAAAACACATATTAAGGG + Intergenic
1001096216 5:168777555-168777577 GATGTTACTTCAAATATGTAAGG + Intronic
1001148509 5:169205475-169205497 CATGGCACTACACATTTGAATGG - Intronic
1002953214 6:1836558-1836580 GATGTCATTATACTAATGAAAGG - Intronic
1006266566 6:32930335-32930357 GATGTCCATAGACAGATGAATGG + Intergenic
1011267384 6:85536197-85536219 TAGGTCAATACACAAATGAAGGG + Intronic
1013625971 6:111937335-111937357 GGTGGCACTATACATTTGAATGG + Intergenic
1014861465 6:126472551-126472573 GATGTCCCTCAACACATGAATGG - Intergenic
1015681129 6:135809652-135809674 GAAGTGACTACACAAAAGAAAGG - Intergenic
1016086116 6:139917193-139917215 GATCTGACTAAAGATATGAAAGG + Intergenic
1018011980 6:159678956-159678978 GATGTTATTACAGATATGACTGG + Exonic
1018217551 6:161544725-161544747 GATGTCAGTCCACCTAGGAAAGG - Intronic
1019207156 6:170371448-170371470 GATGTCATTCCACATATTTAAGG - Intronic
1020312486 7:6879333-6879355 GATATCACGACTCATATCAAGGG - Intergenic
1021536738 7:21713716-21713738 CATGTCAGTACACACAGGAAAGG - Intronic
1023215501 7:37858576-37858598 GATGTCATTACACTCATGAGGGG + Intronic
1025499086 7:61261048-61261070 CAAATCACTGCACATATGAACGG - Intergenic
1026372815 7:69718678-69718700 TATGTTACTACACATAGCAAAGG - Intronic
1031191814 7:118562302-118562324 GATGTCACTTCACATACACAAGG + Intergenic
1039273821 8:35913000-35913022 AATGTCAATACACATACTAAGGG - Intergenic
1042748105 8:72129518-72129540 GATGTGTCTAGACATAGGAAGGG + Intergenic
1043502412 8:80871119-80871141 GCTGTCACTACACAGACCAAGGG - Intronic
1043809170 8:84713945-84713967 AATGTCCATACACAGATGAATGG + Intronic
1048515792 8:135109883-135109905 GGTGTCATTACACATAAGATGGG + Intergenic
1048840422 8:138561084-138561106 GAGGTGACAACACATATGGAGGG - Intergenic
1049679103 8:143908935-143908957 GATGTTATTACACAGATGACAGG - Intergenic
1049874875 8:145010453-145010475 GATGTCAGTAAATAAATGAAAGG - Intergenic
1053456922 9:38240273-38240295 GATGTCACTACACAGCCGAAGGG + Intergenic
1053620768 9:39813019-39813041 AATGTATCTAAACATATGAAAGG - Intergenic
1053791486 9:41689310-41689332 GAGGTCACTGCACATTTGAGTGG - Intergenic
1053878934 9:42572307-42572329 AATGTATCTAAACATATGAAAGG - Intergenic
1053893732 9:42722056-42722078 AATGTATCTAAACATATGAAAGG + Intergenic
1054153674 9:61625461-61625483 GAGGTCACTGCACATTTGAGTGG + Intergenic
1054232758 9:62529388-62529410 AATGTATCTAAACATATGAAAGG + Intergenic
1054263395 9:62894423-62894445 AATGTATCTAAACATATGAAAGG + Intergenic
1054354188 9:64045470-64045492 GAAGTCACTACACATATCACAGG + Intergenic
1054473455 9:65556580-65556602 GAGGTCACTGCACATTTGAGTGG + Intergenic
1054965574 9:71023287-71023309 GCTGTCACTACACATCTGTCAGG + Intronic
1055897668 9:81198158-81198180 GAAGTCATTACACCAATGAAAGG + Intergenic
1059449341 9:114360544-114360566 GGTGCCACTACACACTTGAATGG - Intronic
1203695152 Un_GL000214v1:91734-91756 GAAGTCACTACACATATCGCAGG - Intergenic
1203742519 Un_GL000218v1:14582-14604 GAAGTCACTACACATATCGCAGG + Intergenic
1203702710 Un_KI270742v1:9170-9192 GAAGTCACTACACATATCGCAGG + Intergenic
1203567577 Un_KI270744v1:104837-104859 GAAGTCACTACACATATCACAGG - Intergenic
1203641121 Un_KI270751v1:12329-12351 GAAGTCACTACACATATCGCAGG + Intergenic
1188979293 X:36712722-36712744 TAGGTCATTGCACATATGAAAGG + Intergenic
1189132260 X:38512041-38512063 TATGTATCTACACATAGGAAAGG + Intronic
1195462944 X:105147732-105147754 GATGTCCATAAACAGATGAATGG - Intronic
1199642395 X:149875428-149875450 GAAATCACTAGACATATGAATGG + Intergenic
1201156050 Y:11132059-11132081 GAAGTCACTACACATATCGCAGG + Intergenic