ID: 1184230761

View in Genome Browser
Species Human (GRCh38)
Location 22:43157241-43157263
Sequence CCCCATGAGCACGTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230752_1184230761 15 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1184230750_1184230761 29 Left 1184230750 22:43157189-43157211 CCCAGGGAGGGTGGCCTTTCATA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1184230749_1184230761 30 Left 1184230749 22:43157188-43157210 CCCCAGGGAGGGTGGCCTTTCAT 0: 1
1: 0
2: 2
3: 16
4: 156
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1184230751_1184230761 28 Left 1184230751 22:43157190-43157212 CCAGGGAGGGTGGCCTTTCATAT 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230761 Original CRISPR CCCCATGAGCACGTGTACCC TGG Intronic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
919910213 1:202106506-202106528 CCCCAGGAGCAGGTGCACCTGGG + Intergenic
1066047552 10:31606479-31606501 CCCCAGGACCACCTGGACCCAGG - Intergenic
1067298881 10:44992094-44992116 CTCCATGGGCACCAGTACCCTGG + Intronic
1067804800 10:49385176-49385198 CCCCCAGAGCACCTGGACCCTGG + Intronic
1073266458 10:102230974-102230996 CCCTACGAGGAGGTGTACCCCGG - Exonic
1075374560 10:121968076-121968098 CCCTGTGGGCACGTATACCCAGG - Intronic
1079354068 11:19715408-19715430 CCCCATGCAGAAGTGTACCCTGG - Intronic
1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG + Intergenic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1089650942 11:119912467-119912489 CCCCCTGATCACGTGTCTCCGGG + Intergenic
1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG + Intergenic
1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG + Intergenic
1101318000 12:103647071-103647093 CCACATGAGAAAGTGTACACAGG - Intronic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1105807704 13:23966430-23966452 CCCCATGACCAAGTTTTCCCTGG + Intergenic
1108567958 13:51719920-51719942 CACCATGAGCATGAGGACCCTGG - Intronic
1115933947 14:38530363-38530385 CCCCCTGAGCACTTGTACTGAGG + Intergenic
1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG + Intergenic
1128106549 15:65049760-65049782 ACCCAGGAGCACGTGGAGCCTGG - Intronic
1129892145 15:79078401-79078423 CGGCATGAGCACGTGCAGCCAGG - Intronic
1130062194 15:80578105-80578127 CCCCATGAACATGAGCACCCAGG - Intronic
1131559388 15:93426205-93426227 CACCATGAGCACGTGTCTCCAGG - Intergenic
1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG + Intergenic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1135261062 16:20981305-20981327 ACCCACAAGCACGTGGACCCAGG + Intronic
1135573001 16:23563625-23563647 GTCCTTGAGCACGGGTACCCAGG - Intronic
1141981036 16:87550687-87550709 CCCCATAAGCACGTGGACTGGGG - Intergenic
1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG + Intronic
1152548573 17:81017360-81017382 CCAAAGGATCACGTGTACCCAGG - Intergenic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1160156838 18:76441226-76441248 CCAGGTGAGCAAGTGTACCCAGG - Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1163845850 19:19637743-19637765 CCCCATGAGGTCCTGTCCCCTGG - Intronic
1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG + Intronic
929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG + Intergenic
932873861 2:75430669-75430691 CCCCTTGGGCACGTGTTCTCAGG - Intergenic
937303112 2:120855419-120855441 GTCCATCAGCATGTGTACCCAGG + Intronic
942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
948383404 2:237566966-237566988 GACCATGGGCACGTGTCCCCAGG - Intronic
948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG + Intronic
1170054124 20:12180299-12180321 CTCCCTGAGAACGTGAACCCAGG - Intergenic
1174143482 20:48433746-48433768 CCCCTTGGGCACGTGTTCTCAGG + Intergenic
1176170511 20:63694431-63694453 CCCCAAGAGCACCTGAACCAGGG + Exonic
1177645630 21:23897107-23897129 GCCCATGAGTACTTTTACCCAGG - Intergenic
1179325513 21:40339299-40339321 GCCCACGATCACGTGGACCCTGG - Exonic
1181427314 22:22852057-22852079 CCCCATGTGCTCTTGTTCCCTGG - Intronic
1183457401 22:37930248-37930270 CCCCACAAGCAAGTGCACCCGGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184715849 22:46281404-46281426 ACCCATGAGCTGGTGTGCCCGGG + Intronic
950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG + Intergenic
952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG + Intronic
955244629 3:57212984-57213006 CCCCATGTGCATGTGTGCCAGGG - Intronic
957723225 3:84031642-84031664 CCCTATAAGCACGTGTGGCCAGG - Intergenic
961344181 3:126251156-126251178 CCCCATGGGCACATGTTCTCAGG + Intergenic
962087191 3:132204166-132204188 ACCCAAGAACACGTGTGCCCAGG + Intronic
967539967 3:190656053-190656075 CCCCTTGAGCACCCGCACCCAGG + Exonic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG + Intronic
973625503 4:52768201-52768223 CACATTGTGCACGTGTACCCTGG - Intergenic
976994845 4:91417816-91417838 CACATTGTGCACGTGTACCCTGG + Intronic
977303628 4:95297016-95297038 CCCCACCAGCATGTGTAACCAGG - Intronic
977420239 4:96790549-96790571 CCACATTAGTAGGTGTACCCTGG - Intergenic
979666054 4:123312049-123312071 CCAGATGAGCATGTGTACCATGG - Intronic
984217707 4:176934942-176934964 CACATTGTGCACGTGTACCCTGG - Intergenic
987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG + Exonic
990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG + Intronic
996495009 5:124145258-124145280 CACCATGATCAAGTGTACCAGGG - Intergenic
1003532595 6:6950217-6950239 CCCCTTGAGCACTTGAGCCCAGG - Intergenic
1010465646 6:76165256-76165278 CTCCATGAGAACGTGCACACTGG - Intergenic
1018215662 6:161524861-161524883 CCCAATGAGTAGGTGTACGCAGG + Intronic
1018831692 6:167448516-167448538 CCCCATGAGCCAGGGTCCCCGGG + Intergenic
1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG + Intergenic
1019776433 7:2914277-2914299 CCCAATTAACACGGGTACCCGGG + Intronic
1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG + Intergenic
1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG + Intergenic
1031814652 7:126418336-126418358 ACCCATAAGCATGTGTGCCCTGG - Intergenic
1048215119 8:132486991-132487013 CCCCTTGAGCAAGTGGACTCTGG - Intergenic
1049800250 8:144514330-144514352 CAGCATCAGCACGTGTACCTGGG + Exonic
1051822938 9:21190368-21190390 CCCGTTGAGCACATTTACCCTGG + Intergenic
1055087467 9:72328825-72328847 CACGTTGTGCACGTGTACCCTGG - Intergenic
1056313719 9:85368667-85368689 CCCCATGTGCCCCTGCACCCTGG + Intergenic
1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG + Intergenic
1057967639 9:99519521-99519543 TCCCATGGTCACGTATACCCTGG - Intergenic
1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG + Exonic
1062167629 9:135115827-135115849 TCACATGAGCCCGTGCACCCAGG - Intronic
1062483848 9:136764564-136764586 GCCCAGGAGCAGGTGCACCCAGG - Intronic
1187057303 X:15753115-15753137 CACCATGAGCACATGTTCTCAGG + Intronic
1193882091 X:86936101-86936123 GTCCATGTGCACGTGTACACTGG + Intergenic
1195626753 X:107011461-107011483 CACATTGTGCACGTGTACCCTGG + Intergenic
1201602089 Y:15742379-15742401 CACGATGTGCACATGTACCCTGG - Intergenic