ID: 1184230761

View in Genome Browser
Species Human (GRCh38)
Location 22:43157241-43157263
Sequence CCCCATGAGCACGTGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184230750_1184230761 29 Left 1184230750 22:43157189-43157211 CCCAGGGAGGGTGGCCTTTCATA No data
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG No data
1184230752_1184230761 15 Left 1184230752 22:43157203-43157225 CCTTTCATATGTGTAGTGACATC No data
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG No data
1184230749_1184230761 30 Left 1184230749 22:43157188-43157210 CCCCAGGGAGGGTGGCCTTTCAT No data
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG No data
1184230751_1184230761 28 Left 1184230751 22:43157190-43157212 CCAGGGAGGGTGGCCTTTCATAT No data
Right 1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184230761 Original CRISPR CCCCATGAGCACGTGTACCC TGG Intronic