ID: 1184231811

View in Genome Browser
Species Human (GRCh38)
Location 22:43162486-43162508
Sequence CTCTAAGCTCAGAGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184231805_1184231811 20 Left 1184231805 22:43162443-43162465 CCTTGTAGTAATGCTGGGAGGTC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG 0: 1
1: 0
2: 6
3: 44
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184231811 Original CRISPR CTCTAAGCTCAGAGAGGGGA AGG Intronic
900640907 1:3687704-3687726 CTCTAGGGACAGAGAGGGGAGGG - Intronic
901694040 1:10993282-10993304 CTATAAGCTCCCAGAGGGAAAGG + Intergenic
902251529 1:15156737-15156759 AACAAAACTCAGAGAGGGGATGG + Intronic
902729776 1:18361898-18361920 CTGTAAGCTCCAGGAGGGGAGGG + Intronic
902889801 1:19434272-19434294 ATCGAGGCTCAGAGAGGTGAAGG - Intronic
902930300 1:19726364-19726386 GTTTAAGCTCAGAGAGCCGAAGG - Intronic
903247085 1:22024171-22024193 ACCTAAGCTGAGAGAGGAGATGG + Intergenic
903461205 1:23522077-23522099 GTCACAGCTCAGGGAGGGGAGGG + Intronic
903692675 1:25185389-25185411 CTTTGAGATCATAGAGGGGAGGG + Intergenic
903705943 1:25286016-25286038 GTGGAAGCTCAGAGAGGGCAAGG + Intronic
903721292 1:25407391-25407413 GTGGAAGCTCAGAGAGGGCAAGG - Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903749545 1:25612267-25612289 AGCTAAGATCAGAGAGAGGAAGG - Intergenic
904052925 1:27651063-27651085 TTCTAAGTTCCAAGAGGGGAGGG - Intergenic
904130351 1:28271211-28271233 CTGTAAGCTCAGGGATGGCATGG + Intronic
904557292 1:31373411-31373433 CGCTAAGCTCAAAGAGGGACTGG - Intronic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905696900 1:39981119-39981141 CTCCAGGCTCAGAGAGGACAAGG + Intergenic
906061224 1:42949987-42950009 GTCTCAGCTCAGAGTGGGCAAGG - Intronic
906490950 1:46268109-46268131 CTCAAAGCACTGGGAGGGGAGGG - Intronic
906523139 1:46478955-46478977 CACTAGGCTCAGAGAGGGCCAGG - Intergenic
907341936 1:53741194-53741216 CTGTGAGCTCACTGAGGGGAAGG - Intergenic
907484851 1:54770281-54770303 CTGCAAGCTCCCAGAGGGGAGGG + Intergenic
907960264 1:59272891-59272913 CACTAAACTCAGAGAGAGTATGG - Intergenic
908001273 1:59682719-59682741 CTCTAAGCTCAGAGGAGGGTGGG + Intronic
908421668 1:63964564-63964586 CTGTAAGCTCCGAGTGGGGAAGG - Intronic
908707276 1:66972345-66972367 CTCTAAGCACCACGAGGGGAAGG - Intronic
909702940 1:78547979-78548001 CAGAAATCTCAGAGAGGGGAGGG - Intergenic
911252360 1:95591700-95591722 CTATAAGCTCTCAGAGGGCAAGG - Intergenic
912660061 1:111519664-111519686 CACTAAGCTCGGGGAGGGAAAGG - Intronic
913176244 1:116275717-116275739 CTGCAAGCTCAGAAACGGGAAGG - Intergenic
913234349 1:116767090-116767112 CTCTAAGCACAAAGAGGAAAGGG - Intronic
913996028 1:143652458-143652480 CTGTAAGCTCAGAGGGGAGCCGG - Intergenic
914431860 1:147625880-147625902 CTCTTGGCTCTGAGAGGGAAAGG + Exonic
915251089 1:154589178-154589200 AGCTCAGCTCACAGAGGGGATGG + Intronic
915561279 1:156689705-156689727 CCCCAAGCTCAGAAATGGGACGG - Intergenic
915569789 1:156738322-156738344 CAGTAAGTTGAGAGAGGGGATGG - Exonic
916057318 1:161076658-161076680 CTCTGAGCTTAGAGAGGGGAGGG - Intronic
917030886 1:170690215-170690237 CTATAAGCTCATAGGGGGCACGG - Intronic
919314029 1:195948495-195948517 CTCTGATCTCAGAGTGGGGTTGG - Intergenic
919490815 1:198202904-198202926 CTCTAGGGTCAGGGATGGGAAGG + Intronic
919555359 1:199046170-199046192 CTCTGAGCTAAGAGAGAGCAGGG + Intergenic
919897970 1:202021264-202021286 CCCTCAGCAGAGAGAGGGGATGG - Intergenic
919918568 1:202154188-202154210 CACTCAGCTCCGAGAGGGCAAGG - Exonic
920087128 1:203425662-203425684 CTCTATACAAAGAGAGGGGAGGG + Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920785863 1:209040463-209040485 ATCAAAGCTCAGAGTGGTGAAGG - Intergenic
921902283 1:220463380-220463402 CTCCAACCTCAGAGTGGGGTTGG + Intergenic
922022287 1:221717151-221717173 CTCTGAGGTATGAGAGGGGACGG + Intronic
922051170 1:221991898-221991920 CTTTAAACTCAGAGTGGGGCAGG - Intergenic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
1062918118 10:1257484-1257506 CTCCCAGGTTAGAGAGGGGATGG - Intronic
1064191244 10:13207871-13207893 CTCTAAGCTAGGTAAGGGGAAGG + Intronic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1066647391 10:37623667-37623689 CTCTAAGCAAAGAAAGGAGAGGG + Intergenic
1070332827 10:75430567-75430589 CTCCCAGCTGAGAGAGGGGCAGG + Intergenic
1070751193 10:78965031-78965053 GTCGAGTCTCAGAGAGGGGAAGG - Intergenic
1070785455 10:79159822-79159844 AACTGAGATCAGAGAGGGGAAGG - Intronic
1070802727 10:79253035-79253057 TTTTAAGCTCCCAGAGGGGAGGG - Intronic
1072518507 10:96210107-96210129 GTATAAGCTCAGAGCTGGGATGG + Intronic
1072524580 10:96260001-96260023 CCCTAAAGTCAGAGAGGGGAAGG - Intronic
1073046474 10:100642000-100642022 CTCTAAGCTCTCTGAGGGCAGGG + Intergenic
1074495639 10:113977936-113977958 CTATAAGCCCAGAGAAAGGATGG - Intergenic
1074720904 10:116264297-116264319 CTTGAAGCTCAGAGAGGGGAGGG - Intronic
1074795847 10:116942772-116942794 CTATAAGCTCCAAGAGGGTAGGG + Intronic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1076559601 10:131352857-131352879 CTCTATCCTCAGGGATGGGAGGG - Intergenic
1077219020 11:1407220-1407242 CACCAAGCTCAGAGAGGGCAGGG - Intronic
1078139216 11:8679815-8679837 CTGTAAGGTCAGAGAGGGACTGG + Intergenic
1078439614 11:11353333-11353355 CTCTCAGATTAGAGATGGGAAGG - Exonic
1079710794 11:23680267-23680289 CTCTGATCTCAGAGAAGGGTTGG - Intergenic
1080437016 11:32254573-32254595 CTAGAACCTCAGAGAGGGGCAGG + Intergenic
1081968070 11:47181459-47181481 CTGGAAGCTCAGAGAGGCTAAGG - Intronic
1082028251 11:47587868-47587890 CCCTAAGCTCAGGGTTGGGAAGG + Intronic
1083329513 11:61891049-61891071 GTCAAAGGTCAGCGAGGGGAGGG + Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1084174617 11:67416757-67416779 CGCCAGCCTCAGAGAGGGGAGGG + Intronic
1084408251 11:68991368-68991390 CCCGAAGCTCTGAGAGAGGAGGG + Intergenic
1084467495 11:69334561-69334583 CACTGAGCTTGGAGAGGGGAAGG - Intronic
1084876586 11:72137935-72137957 CTCTACCCTCAGGGAGGGTATGG - Intronic
1085041693 11:73330698-73330720 ATCTAGGCCCAGAGAGGGGATGG - Intronic
1085455375 11:76662451-76662473 ATCTAGGCTCAGGGAGGGGAAGG + Intronic
1085854026 11:80155704-80155726 CTCTTAGCTCAGATAAGGCATGG - Intergenic
1086092684 11:83020310-83020332 CTCTAATCTCAGAGCAGGGTTGG + Intronic
1086944308 11:92830017-92830039 ATATAAGCTCTTAGAGGGGAGGG - Intronic
1087287490 11:96280870-96280892 CTATAAGCTCCCAGAGGGGTAGG + Intronic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088569195 11:111204856-111204878 CTCTAAGGTCTTAGAGGGCAGGG + Intergenic
1089634768 11:119805049-119805071 GCTTAAGCCCAGAGAGGGGAAGG + Intergenic
1090451643 11:126811366-126811388 CTGTAAGCTCCAAGAGGGTAGGG + Intronic
1091664545 12:2409881-2409903 CTCTCAGGTCAGGGAGGAGAGGG + Intronic
1091785171 12:3238974-3238996 ATCTCAGCCCAGAGAGGGGTAGG + Intronic
1091847958 12:3672023-3672045 CCCAAAGCTCAGAGAAGGGAAGG - Intronic
1093250076 12:16792133-16792155 CTCTAAGCTCAGAGTTAGGATGG - Intergenic
1095042244 12:37455717-37455739 CTCTGATCTCAGAGTGGGGCTGG + Intergenic
1095722181 12:45412794-45412816 CGCTGAGCTCCGTGAGGGGAGGG - Intronic
1096153063 12:49326502-49326524 ACCAAAGCTCAGAGAGGTGAAGG - Intronic
1096226740 12:49870892-49870914 CTCTAAGCTCTGTGAGGACAGGG - Intronic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1097985116 12:65774967-65774989 TTGTAAGCTCAGTGTGGGGAGGG - Intergenic
1101408503 12:104450255-104450277 CTCTGAGCTTTCAGAGGGGATGG - Intergenic
1102179349 12:110900503-110900525 CCCTAAGCTCAGAGAGGACAGGG + Intronic
1102248258 12:111368716-111368738 CTATGGGCTGAGAGAGGGGAGGG + Intronic
1102629811 12:114268128-114268150 ATTAAAGCTCAGAGAGGGGAAGG + Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102650871 12:114441519-114441541 CTCCAGGCCCAGAGAGGGGAAGG + Intergenic
1102780292 12:115558492-115558514 CTCTAAGCTGTGCCAGGGGAGGG - Intergenic
1102921715 12:116796511-116796533 CTCTAAGCACAGGGACGGGGAGG + Intronic
1103560873 12:121792907-121792929 CTCTCAGCACAGAGCTGGGAGGG + Intronic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1105622405 13:22081087-22081109 CTCTAAGCCAAGCGAGGGGAGGG - Intergenic
1106571978 13:30935193-30935215 CTCTGATCTCAGAGTGGGGTTGG + Intronic
1106665208 13:31844797-31844819 TTTGAAGCTCAGAGAGGTGAAGG - Intergenic
1106901366 13:34357713-34357735 CTCTAGGCTCTGAGAGCAGATGG - Intergenic
1106976607 13:35225304-35225326 CTCTACTCTGAGGGAGGGGAAGG - Intronic
1110305690 13:73984461-73984483 CTCTAACTTCAGAGAGGCCAGGG - Intronic
1111040453 13:82740686-82740708 CTCTGAGCCCAGAGAGAGCAGGG - Intergenic
1112431301 13:99352736-99352758 CTCTAAGCTCAGGGAGAGGAGGG - Intronic
1113074520 13:106454784-106454806 CTCTAAGCTCACAGAGTGGAAGG + Intergenic
1115630700 14:35241970-35241992 CTCTAAACTCACTGAGGGCAGGG + Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1119420415 14:74504876-74504898 GTTTCAGCTCAGAGTGGGGAGGG + Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121537240 14:94699315-94699337 GACTAGTCTCAGAGAGGGGAAGG + Intergenic
1122429910 14:101634005-101634027 CCTGAAGCTCAGAGAGGTGAAGG - Intergenic
1122944063 14:104997316-104997338 ATCCAAACACAGAGAGGGGAGGG + Intronic
1202940767 14_KI270725v1_random:143442-143464 CTCTGATCTCAGAGTGGGGTTGG + Intergenic
1124508706 15:30303916-30303938 CTCTCAGCTCACAGATGAGAAGG + Intergenic
1124734852 15:32234746-32234768 CTCTCAGCTCACAGATGAGAAGG - Intergenic
1125334532 15:38614459-38614481 CTGGAAGCCCATAGAGGGGAAGG - Intergenic
1125722013 15:41849704-41849726 CTCTCAGCTGAGAGTGGGCAGGG + Intronic
1125967175 15:43883799-43883821 CTTTAACCTCAGAGCAGGGATGG - Exonic
1126292697 15:47099804-47099826 CTCTGACCTCAGAGTGGGGTTGG - Intergenic
1127480747 15:59374690-59374712 TTGTAAGCTCAGTGAGGGCAGGG - Intronic
1127611345 15:60640497-60640519 CTCTAAGTTCAGCCACGGGAGGG - Intronic
1127701346 15:61504520-61504542 ATCTCAGCTCAGTGTGGGGAGGG - Intergenic
1127864267 15:63019122-63019144 CTGCCAGCTCAGAGATGGGATGG - Intergenic
1128052872 15:64678870-64678892 CTGTAAGCTCCGGGAGTGGAAGG - Intronic
1128679557 15:69638113-69638135 CTCTAAGCTCTCTGAGGGCAGGG + Intergenic
1129302534 15:74633812-74633834 CTCTAGGCTGAGAGCTGGGAAGG - Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1130297214 15:82655905-82655927 CAATGAGCTCAGAGAGGGGCTGG - Intergenic
1130550877 15:84889253-84889275 GTAGAAGCCCAGAGAGGGGAAGG + Intronic
1131078863 15:89517238-89517260 CTCTAAGTTCTGGGAGGGGCAGG - Intergenic
1131086404 15:89579202-89579224 CTATAAGCTCCAAGAGGGCAGGG - Intronic
1131171803 15:90184517-90184539 CTCCAGGCTCAGAGAGGTTAAGG + Intronic
1133279307 16:4656040-4656062 CACCAAGCTCAGAAATGGGATGG - Intronic
1133400976 16:5486745-5486767 CTCCAAGCTCAGAAATGGGAAGG - Intergenic
1134911158 16:18027863-18027885 ATGTAAGCTCAGGGAGGGCAGGG - Intergenic
1137256345 16:46778303-46778325 CTCTCATCTCAGAGTGGGGTTGG + Intronic
1138161331 16:54757603-54757625 CTCTAAGCTCATCGAGGGCAAGG + Intergenic
1138490582 16:57373940-57373962 TACTAAGCTGAGAGAGGGAAGGG + Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1139268182 16:65658887-65658909 CTCTAAGCTCCAAGAGGAGAAGG + Intergenic
1140118975 16:72067036-72067058 CCCAAAACTGAGAGAGGGGAAGG + Intronic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1141053401 16:80793643-80793665 CCCTAAGCTCGGTGAGGGCAGGG - Intronic
1141900328 16:86986862-86986884 CTCCCAGATCAGGGAGGGGAGGG + Intergenic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142285616 16:89170373-89170395 CTCCAAGATGAGAGAGGGCAGGG - Intergenic
1142407082 16:89896216-89896238 CCTTAAGCCCAGAGAGAGGAAGG - Intronic
1142969589 17:3602289-3602311 AGCTAGGTTCAGAGAGGGGAGGG - Intergenic
1143033705 17:3982476-3982498 CACTAAGGCCAGAGAGGGCAAGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143324163 17:6087619-6087641 CTCTGAGCCCAGGGAGGGCAGGG + Intronic
1144058615 17:11561913-11561935 CTCTGAGCTCTGGGAGGGAAGGG + Exonic
1144115216 17:12082379-12082401 TTTTAAGCTCAGAGAGGGTATGG - Intronic
1144771308 17:17761088-17761110 CTCTGAGCACAGAGAGGACAAGG - Intronic
1145240470 17:21238091-21238113 CTCTGTGATCAGAGAAGGGAAGG - Intergenic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1145783400 17:27578542-27578564 GACTGAGCTCAGAGAGGGAAAGG + Intronic
1146113360 17:30111980-30112002 GTCTAAGCTCAGACAGTAGATGG - Intergenic
1147118066 17:38317369-38317391 CTCTAAGCCCAGAATGGGTAAGG - Intronic
1147280263 17:39354501-39354523 CTATAAGCTCTGAGAGGAAAGGG + Intronic
1148775486 17:50093125-50093147 CTTTAAGCTCCGTGAGGGCAGGG - Intergenic
1149323849 17:55509732-55509754 CTCTGAGCTCAGGGAAGGGAGGG + Intergenic
1149538768 17:57452908-57452930 CTCTAACCTCAGACTGGGGAAGG + Intronic
1149604689 17:57916396-57916418 CTTTGATCCCAGAGAGGGGAGGG + Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150577128 17:66440487-66440509 CTCTAAGCTCTGAAGGGGCAGGG - Intronic
1151399954 17:73849553-73849575 CTCTGAGGTCGGAGGGGGGAAGG + Intergenic
1151989364 17:77564400-77564422 CTCTAGGCTCAGAGAAGGGAGGG - Intergenic
1152368344 17:79870281-79870303 CTCCAACCTCAGAAAAGGGACGG - Intergenic
1152705318 17:81840724-81840746 CTCTGACCTCAGGGAGGGAAGGG - Intergenic
1154073062 18:11172675-11172697 CTCAAAGATGACAGAGGGGAAGG + Intergenic
1155031646 18:21990221-21990243 CTGGAAGCTCAGAGAAGAGACGG - Intergenic
1157069571 18:44390279-44390301 CTCTAAGCTCAGCAAAGGCAGGG + Intergenic
1157320120 18:46627935-46627957 CTCTAAGCTCCTAGAGAGAAGGG + Intronic
1157870116 18:51222456-51222478 CTCCAAGCTCTGTGAGGGCAAGG + Intergenic
1158346343 18:56520564-56520586 CCCTACTCTCAGTGAGGGGAGGG - Intergenic
1158572643 18:58610039-58610061 TTCTAAGTCCAGAGAGGAGAGGG - Intronic
1158974347 18:62697219-62697241 CTCTAAGATCCAAGAGGGGTGGG + Intergenic
1160241350 18:77125467-77125489 TTCTAATCTCGGGGAGGGGAGGG - Intronic
1160292781 18:77609356-77609378 CTCCAATCTCAGAGTGGGGTGGG + Intergenic
1160688133 19:446808-446830 ACCGAAGCCCAGAGAGGGGATGG + Intronic
1160814038 19:1027152-1027174 CTCTTAGCTTTGGGAGGGGAAGG + Intronic
1161162461 19:2768832-2768854 AGCTAAGCCCAGAGAGGGCAGGG - Intronic
1161827773 19:6580465-6580487 GTCCCAGCTGAGAGAGGGGAAGG - Intergenic
1161972568 19:7590770-7590792 CGCCAAGCTCACAGAGGGGCAGG + Intergenic
1162312693 19:9916498-9916520 AACTGAGCTCAGAGAGGAGAGGG + Intronic
1162366193 19:10251172-10251194 CTGGAAGGTCTGAGAGGGGACGG + Intergenic
1165389859 19:35532509-35532531 CTGTAAGCTCTGAGAGGACAGGG - Intergenic
1167235044 19:48309162-48309184 CTCTGATCTCAGAGAGGGGTTGG + Intronic
1167346163 19:48946881-48946903 CTCTGATCTCAGAGTGGGGTTGG + Intergenic
1167414471 19:49362762-49362784 CTCCTAGGTCTGAGAGGGGACGG + Intronic
1167460320 19:49621228-49621250 CTCTTGGGTCAGAGAGAGGAGGG + Intronic
1167650551 19:50726258-50726280 CCCGAGGCTCACAGAGGGGAAGG - Intergenic
1167732127 19:51265971-51265993 CCCTAAGCTCCTTGAGGGGAGGG - Intronic
1168094443 19:54106717-54106739 CTTTATGTTCAGAGAGGGAAGGG - Intronic
1168125027 19:54278224-54278246 CTTTGAGCTCAGAGAGGACAGGG + Intronic
1168176959 19:54633332-54633354 CTTTGAGCTCAGAGAGGACAGGG - Intronic
1168181300 19:54664499-54664521 CACTGAGCTCAGAGAGGACAGGG - Intronic
1168185773 19:54698511-54698533 CTTTGAGCTCAGAGAGGACAGGG - Intronic
1168322963 19:55521365-55521387 CTCTAAGCCGAGAGAGGAGGAGG - Intergenic
926329043 2:11809917-11809939 AACAAAGCTCAGAGTGGGGAAGG - Intronic
926638959 2:15214736-15214758 CTCTGAGCTCTGAGAGGGAAGGG + Intronic
927870534 2:26620127-26620149 CCCTAAGCCCACAGTGGGGAAGG + Intronic
928328424 2:30338295-30338317 CTCTAAGCTCCACGAGGGTAAGG - Intergenic
928589881 2:32803220-32803242 ATCTAACCTCAGTGAGTGGAGGG + Intronic
929244318 2:39685482-39685504 CTCTAAGCTCTGTGAGGGTAGGG + Intronic
929560408 2:42952981-42953003 CACTCAGCTCTGAGAGGAGAAGG - Intergenic
929574110 2:43041541-43041563 CTTGAAGTTCAGAGAGGAGAAGG + Intergenic
929904835 2:46036660-46036682 CTCAAAACTCTCAGAGGGGAGGG + Intronic
932340621 2:70960805-70960827 ATCCAAGCCCAGAGAGGTGAGGG - Intronic
932456567 2:71853151-71853173 CTCCAAGATCAGAGAGCTGAGGG + Intergenic
932594878 2:73087613-73087635 CTCTAGCTCCAGAGAGGGGAAGG + Intronic
932675454 2:73776781-73776803 CACTAAGCTCAGAGAATAGATGG - Intronic
934094657 2:88589527-88589549 ATCTAATCTTAAAGAGGGGAGGG + Intronic
934737529 2:96697455-96697477 CTCTGACTTCAGAGAGGAGAGGG - Intergenic
934907580 2:98218844-98218866 CTTTAAGCTCACAGAGGGCTGGG + Intronic
937119758 2:119433064-119433086 CTGTAAGCTCCTAGAGGGGAGGG - Intronic
937415430 2:121710796-121710818 GCCTAGGCTCAGAGAGGGAAGGG + Intergenic
937856096 2:126672878-126672900 CTCTGATTTCAGAGAGGAGAAGG - Intronic
938100800 2:128496951-128496973 CTCCAAGCCCAGACAGTGGAGGG - Intergenic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
939302497 2:140362873-140362895 TTCTAAGCTCTGTGAGGTGAGGG + Intronic
940013465 2:149079148-149079170 CTCTAAGCTCTGTGAGGGCGGGG + Intronic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
944898108 2:204186584-204186606 CTCTTTGCTCAGAGAGGTGAAGG - Intergenic
945567155 2:211414756-211414778 TTCTAAGCTAACAGAGGGGATGG - Intronic
945726498 2:213476760-213476782 CTCTTAGCTCAGGTAGTGGAAGG + Intronic
945891809 2:215437299-215437321 CTCTAAACTCAGAGTGGAAAGGG + Intergenic
946603413 2:221375504-221375526 CTCTTAGGTCAGTGATGGGATGG - Intergenic
947242652 2:228013143-228013165 TTCTAAGCTCAGAGATGTTATGG - Intronic
947351721 2:229253246-229253268 CTCTAGGCTCAGAGATAAGAGGG + Intronic
1168949614 20:1787688-1787710 CTCTAAGATCAGCCAGGAGAGGG - Intergenic
1169071569 20:2735767-2735789 CTGTAAGCTCTCAGAGGGCAGGG - Intronic
1169075421 20:2757121-2757143 CTCCAGGCTGAGACAGGGGAGGG + Intronic
1170359297 20:15527090-15527112 CTCTGAGCTCAGACAAGGGGAGG - Intronic
1170568737 20:17621214-17621236 CTCTAAGCTGGGGAAGGGGAAGG - Intronic
1170896643 20:20420842-20420864 GTCTGAGCTCAGAGAAGGAATGG + Intronic
1171295673 20:24014691-24014713 CCCTAGGATCAGAGTGGGGAAGG + Intergenic
1171536679 20:25898789-25898811 CTCTGATCTCAGAGTGGGGTTGG + Intergenic
1171804430 20:29662368-29662390 CTCTGATCTCAGAGTGGGGTTGG - Intergenic
1172228225 20:33319590-33319612 CTCTCAGCTCAGGGAGGTGCTGG + Intergenic
1172637047 20:36417011-36417033 CTGTGAGCTCCAAGAGGGGAGGG - Intronic
1172702119 20:36860153-36860175 CGCTAAGGCCAGAGAGGGGAAGG - Intronic
1173159433 20:40641382-40641404 GTAAAGGCTCAGAGAGGGGAAGG - Intergenic
1173404770 20:42754961-42754983 ATCTAAGCTCTGTGAGAGGAGGG - Intronic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1174031526 20:47632298-47632320 CTATAAGCCCAGAGAGGGCATGG - Intronic
1174449140 20:50609126-50609148 CACCAGGCTCAGAGAGGGGTGGG + Intronic
1174768066 20:53272368-53272390 CTCGAAGCTCTGGGAGGGCAGGG + Intronic
1175321118 20:58089060-58089082 CTATTTGCTCAGAGAGTGGATGG + Intergenic
1175717076 20:61262313-61262335 CTCTAAGCTGAGAGAGAGCAAGG + Intronic
1176582387 21:8543500-8543522 CTCTGATCTCAGAGTGGGGTTGG - Intergenic
1177623701 21:23631150-23631172 CTATAAGATCTGAGAGTGGAGGG - Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178904846 21:36628278-36628300 CTCTCAGCTCACAGAGCAGAAGG - Intergenic
1179626271 21:42651236-42651258 CTGTGAGGTCAGAGAGGTGACGG - Intergenic
1180265221 22:10520548-10520570 CTCTGATCTCAGAGTGGGGTTGG - Intergenic
1180614416 22:17118666-17118688 TTCTCAGCTCAGGGAGAGGAGGG - Exonic
1181137805 22:20781283-20781305 CTCTAAGCTGAGAGTGTGGAAGG + Intronic
1181413078 22:22738670-22738692 CTCTGAGCCCACAGCGGGGAGGG - Intronic
1181963340 22:26638802-26638824 CTCTTTGCCCAGAGAGGGAAGGG + Intergenic
1182785590 22:32905020-32905042 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1183290345 22:36998299-36998321 CTCTGAGCTTGGAGAAGGGATGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183909480 22:41067735-41067757 CTTTATGCTAAGAGAGGGGTAGG - Intergenic
1184054329 22:42034154-42034176 CTCTGAGATCAGAGAAGGCAGGG + Intronic
1184117335 22:42429888-42429910 CTCAAAGCTCTGAGACGAGAAGG + Intronic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184445812 22:44546169-44546191 CTCAACGCTCAGAGAAGTGAGGG - Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184598660 22:45529531-45529553 GGCAAAGCTCAGAGAGAGGAGGG - Intronic
949832163 3:8226413-8226435 CTCCAAGCTCGGACAGGAGAAGG - Intergenic
950040107 3:9914843-9914865 CTGAGAGCTCAGACAGGGGAGGG - Intronic
950235504 3:11316613-11316635 CTGTAAGCTCCAAGAGGGCAGGG + Intronic
950912399 3:16607803-16607825 TTATAAACTGAGAGAGGGGAGGG - Intronic
951569215 3:24044495-24044517 CTGTAAGCTCCCAGAGGGCAGGG - Intergenic
952817623 3:37459422-37459444 CTCTAAGCTCACACAGTGAAAGG + Intronic
952843605 3:37668490-37668512 CTCCAAGTTGAGAGAAGGGAGGG - Intronic
953719243 3:45340866-45340888 CTGTAAGATCAGAGATTGGAGGG - Intergenic
953746898 3:45581939-45581961 CTGTAAGCTCTGTGAGGGTAAGG - Intronic
953778145 3:45841127-45841149 CTCTAAACTCAAGAAGGGGAGGG + Intronic
954258191 3:49420583-49420605 CTCTCAGTACAGAGTGGGGAGGG - Intronic
954414642 3:50387263-50387285 CTCTAAGTGCAGTGAGAGGAGGG - Intronic
955031915 3:55230282-55230304 CTCTGGGGTCAAAGAGGGGAAGG + Intergenic
956083142 3:65580981-65581003 CCCTAAGCTCAGAGAAGGGCTGG - Intronic
956189624 3:66596357-66596379 CAGTAAGCTCAGTGAGGGCAAGG - Intergenic
956484217 3:69704325-69704347 CTATAAGGTCAGAGTTGGGAGGG + Intergenic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
959592357 3:108094089-108094111 CTGTAAGCTCAATGAGGGGAGGG + Intergenic
960140661 3:114149114-114149136 CTCTAAGCTCAAAGAGAACAGGG - Intronic
960361872 3:116722628-116722650 CTCTAAGCTCCAAGAAGGTAGGG + Intronic
960596994 3:119415573-119415595 CCCTGAGCTCTGAGAGGGCAGGG - Exonic
961103145 3:124219205-124219227 CTCTAAGCTCATTGATGGCAGGG - Intronic
962400508 3:135055366-135055388 CTCTCAGCACAGACAGGGGCTGG - Intronic
962605025 3:137025850-137025872 ATCAAAGCTCAGAGAGGCCAAGG - Intergenic
962921654 3:139955772-139955794 CTCTATGCTCTGAGAGAGAAAGG + Intronic
963040184 3:141064720-141064742 CTCTCAGGCCAGGGAGGGGAGGG + Intronic
963953986 3:151233060-151233082 CTCTGAGCTCCAAGAGGGCAGGG - Intronic
965542020 3:169880170-169880192 CTCTGATCTCAGAGTGGGGTTGG + Intergenic
966368918 3:179225242-179225264 CTGTAAGCTCCAAGAGGGCAGGG - Intronic
967891897 3:194369619-194369641 CTCTAAGCAGAGAGGAGGGATGG + Intronic
967937129 3:194738206-194738228 ATGTCAGCTCAGAGAGGGAAGGG + Intergenic
968187331 3:196642128-196642150 CTGAAAGCTCAGAGACGTGAAGG + Intronic
969390741 4:6889889-6889911 CACTAAGATCAGTGAGGGCATGG - Intergenic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
969905053 4:10386021-10386043 CTCAAAGATCAGAGAGGAAAGGG + Intergenic
973769958 4:54197283-54197305 TTCTAAGCAGAGAGAGGAGATGG + Intronic
975860208 4:78669051-78669073 CTATAAGCTCAATGAGGGCAAGG - Intergenic
978712302 4:111799057-111799079 TTCTATGCACAGAGTGGGGAGGG + Intergenic
981237526 4:142436001-142436023 CACTAAGCTCCCAGTGGGGAAGG + Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981774147 4:148345857-148345879 CTATAACCTCTGAGAAGGGAGGG - Intronic
983057125 4:163111360-163111382 CTTTATGCTCAGAGATGGGGAGG - Intronic
983782707 4:171691870-171691892 GTCAGAGCTGAGAGAGGGGAAGG + Intergenic
984258168 4:177411802-177411824 CTATAAGCTCCAAGAGGGCAGGG + Intergenic
984677222 4:182563445-182563467 ATTTAGGCTTAGAGAGGGGAAGG + Intronic
985100958 4:186458200-186458222 TTATAAGGTCAAAGAGGGGAGGG - Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985301640 4:188496384-188496406 CCCAAAGCTCAGAGCTGGGAGGG - Intergenic
985558646 5:570403-570425 ACCTAATCTCATAGAGGGGATGG - Intergenic
986343348 5:6811740-6811762 TCCTAAGCTCAGAGAGGTGCTGG - Intergenic
986530150 5:8727393-8727415 CTCTACGCTTACAGAGGTGAGGG + Intergenic
987188549 5:15450289-15450311 CTCTAAGCCCAGAGATGGGAGGG + Intergenic
987417634 5:17680701-17680723 CACTAAGCTCTGTGAGGAGATGG + Intergenic
990240757 5:53814002-53814024 CTGTAAGCTGGGAGAGGGCAAGG - Intergenic
991096522 5:62745441-62745463 CTTTAAGCTCGGTGAGGGCAGGG + Intergenic
991453401 5:66777082-66777104 ATCGAAGCTCAGAGAGGTCAAGG + Intronic
994356614 5:98800396-98800418 TTTTAAGATCAGAGAGGAGAAGG - Intergenic
996543601 5:124654618-124654640 TTGTGAGCTCAGAAAGGGGAGGG - Intronic
996684943 5:126269719-126269741 GTCTGAGCTCAGAGATGGGGAGG - Intergenic
997960372 5:138316247-138316269 CTCCAATCTCAGAGTGGGGTTGG + Intronic
998113799 5:139521520-139521542 GGCCAACCTCAGAGAGGGGAGGG + Intergenic
998656519 5:144186966-144186988 CTGTAAGCGCTGAGAGGGAAGGG - Intronic
999155315 5:149453632-149453654 CTGTAAGCTCCGCGAGGGCAGGG + Intergenic
999293041 5:150440115-150440137 CTATGAGCTCTGAGAGGGCAGGG + Intergenic
999294908 5:150453109-150453131 GTGTGAGCTCTGAGAGGGGAGGG - Intergenic
999325853 5:150642869-150642891 TTCTAAGCTCAGAGAGGTGGTGG + Intronic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
999887249 5:155936972-155936994 CTCTAATCTCAGAGTGAGGGCGG - Intronic
999892248 5:155991516-155991538 CTCTAAGCTCAGAAGGGAGAAGG + Intronic
1000094412 5:157958557-157958579 CTGTAAGATCAGAGAGGACAAGG - Intergenic
1000201268 5:159013297-159013319 CTGTAAGCTCACTGAGGGCAGGG - Intronic
1000976111 5:167766169-167766191 ATTTAAGCTCAGAGAGGGTGAGG + Intronic
1001154103 5:169258091-169258113 TTCTAAGCTTAGGGTGGGGATGG - Intronic
1001953345 5:175831309-175831331 ATCGTAGCTCAGAGAGGGGAAGG + Intronic
1003280949 6:4690827-4690849 AGCTAAGCTCAGAGAAGGGTAGG - Intergenic
1003375504 6:5573218-5573240 CTATAATCTCAGTGAGGGAAGGG - Intronic
1003974482 6:11329616-11329638 TTGTAAGCTCTAAGAGGGGAGGG - Intronic
1004576140 6:16897060-16897082 CACTAAGCTTGGAGAGGAGAAGG + Intergenic
1005636142 6:27755160-27755182 CTCTAAGCACAGAGAGTGTGTGG - Intergenic
1005708467 6:28480779-28480801 CTTGAACCTCAGAGAGGGCATGG + Intergenic
1007026010 6:38574948-38574970 GCCTAAACTCAGAGAGAGGACGG + Intronic
1007392374 6:41557117-41557139 CCCTAAGGTCAGAGTGGGGTAGG - Intronic
1008537673 6:52519196-52519218 CGCTAAGCTCCAAGAGGGCAGGG - Intronic
1009952460 6:70413364-70413386 GCCTAGCCTCAGAGAGGGGAGGG + Exonic
1013605330 6:111742183-111742205 ATCTAACCTCAGAGAGGTTAAGG + Intronic
1014976615 6:127892482-127892504 ATATAAGCTCCGAGAGGGGAGGG + Intronic
1015636004 6:135274892-135274914 CTCTAAGTTCACAGCGTGGAAGG + Intergenic
1016143050 6:140637121-140637143 CTGTAAATTCAGAGAGGGAAAGG - Intergenic
1016339719 6:143049664-143049686 CTCTAATCTCAGAGCCGGGTTGG - Intergenic
1016732408 6:147440746-147440768 CTCTAATCTCACATAGTGGAAGG + Intergenic
1016854124 6:148649581-148649603 GTCAGAGCTTAGAGAGGGGAGGG - Intergenic
1017602097 6:156094801-156094823 CTAGAAGCCCAGAGAGTGGAGGG - Intergenic
1018579141 6:165292671-165292693 CTCTGAGCCCTGAGAAGGGATGG + Intronic
1019182839 6:170202628-170202650 CTGTAAGCTCAGGGAGGGCGGGG - Intergenic
1019273405 7:163416-163438 CCCTAAGCTCAGAGACGTGGTGG - Intergenic
1019570741 7:1710896-1710918 CTTGAAGCCCAGAGAAGGGAAGG + Intronic
1021244424 7:18244468-18244490 CTGTAAGCTCAGAGAAGTCAAGG - Intronic
1021873067 7:25022672-25022694 CTCTAGGCTTTGAAAGGGGAGGG - Intergenic
1021952221 7:25786098-25786120 CTCTAACCCCAGAGGGTGGAAGG - Intergenic
1023574589 7:41612874-41612896 CTCTAAATTCAGAGTGAGGAAGG - Intergenic
1024053649 7:45645975-45645997 TTCTAATCTCAGGGAGGGGGTGG + Intronic
1025003694 7:55339295-55339317 CTCAAAGCCAAGAGAGGAGAGGG + Intergenic
1025249577 7:57342987-57343009 ATGTGAGCTCAGAGAGGTGAAGG - Intergenic
1025288150 7:57685497-57685519 CTCTGATCTCAGAGTGGGGTTGG + Intergenic
1027224221 7:76233954-76233976 CTCTGAGGCCAGAGAGGGGAGGG + Intronic
1027535983 7:79402505-79402527 ATAGAAGCTCAGAGAGGGTAAGG + Intronic
1030876533 7:114820183-114820205 CTCTAACCTGGGAGTGGGGATGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032311446 7:130791106-130791128 CTAAAAGCTCAAAGAGGGCAGGG - Intergenic
1032500245 7:132394608-132394630 ATCTTAGCCCAGAGAGGTGAAGG - Intronic
1033000860 7:137502857-137502879 CACTGAGCTCAGAGAAGTGAAGG + Intronic
1034214341 7:149393629-149393651 CTGTATGCTCACAGAGTGGAAGG + Intergenic
1034564271 7:151900829-151900851 CTCTACTCTCAGGGAGAGGAAGG + Intergenic
1035032629 7:155871377-155871399 CTCTGAGCTCAGCGGCGGGAAGG + Intergenic
1035178964 7:157075655-157075677 CTCCAAGCAGAGAGAGGGAAAGG - Intergenic
1035957451 8:4097105-4097127 CTCAGAGTGCAGAGAGGGGAAGG - Intronic
1036595083 8:10204886-10204908 CTGCAAGCTCAGGGAGGGCAGGG - Intronic
1036712591 8:11091035-11091057 CTCTCACCTAAGAGAGAGGATGG - Intronic
1038184189 8:25258092-25258114 CTGGAAGCTCAGTGAGAGGAAGG - Intronic
1038278634 8:26142816-26142838 CTGTAAGCACAGAGAGGTGAAGG + Intergenic
1038506427 8:28088910-28088932 GTTTTATCTCAGAGAGGGGAGGG - Intergenic
1038943875 8:32335806-32335828 CTCTCAGCACAGCGAGGAGACGG - Intronic
1040545724 8:48396790-48396812 CTCTCACCCAAGAGAGGGGATGG - Intergenic
1041194585 8:55387886-55387908 CACTGAGCTGAGAGATGGGAGGG + Intronic
1041333099 8:56749907-56749929 TTCTAAGCACGGAGAGGGGAAGG - Intergenic
1042504320 8:69543379-69543401 CACTAAGGTCTGTGAGGGGAGGG - Intronic
1042823142 8:72953635-72953657 CTGTAAGCTCTTTGAGGGGAGGG - Intergenic
1043082684 8:75785180-75785202 CTATAAACTCAGAAAGGGGTGGG + Intergenic
1044835453 8:96291178-96291200 CTCTAAGCTCTAAGAGGACAGGG - Intronic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1045548346 8:103148305-103148327 CTGGAAGCTCAGAGAGAGGCAGG + Intronic
1045639020 8:104226542-104226564 CTGAAAGCTCTGAGAGGGAAAGG - Intronic
1046612370 8:116440275-116440297 CTGGAAGCTCAGAGAGTGAAGGG - Intergenic
1047303484 8:123634913-123634935 ATTGAAGCTCAGAGAGGTGAAGG + Intergenic
1047393484 8:124473731-124473753 CTCTAAGCAGAGAAAGGGGTTGG + Intergenic
1047483356 8:125305842-125305864 CTATAAGCTCTGTGAGGGCAAGG - Intronic
1047954313 8:129961600-129961622 CTGTAAGCTCCAAGAGGGCAGGG + Intronic
1049174750 8:141184962-141184984 CTCTGAGCTCCCAGAGGGCAGGG + Intronic
1049399037 8:142416658-142416680 CTCCAAGCTCAGAGGGGTGCTGG - Intergenic
1050692453 9:8243124-8243146 CTATAAGCTCCGTGAGGGCAGGG - Intergenic
1051906081 9:22096407-22096429 CTGTAACCTCAATGAGGGGAGGG - Intergenic
1052341360 9:27367187-27367209 ATCAAAGCTCAAAGAGGTGAAGG + Intronic
1053517038 9:38739366-38739388 CTGGAAGCTCTGAGAGGAGATGG + Intergenic
1054907378 9:70422689-70422711 TTCTCAGCTCAGAGTGAGGAAGG - Intergenic
1057012412 9:91616883-91616905 ATTGAAGCTCAGAAAGGGGAAGG + Intronic
1057479582 9:95434135-95434157 CTCAGAGCTCAGGGAGTGGAGGG - Intergenic
1058425047 9:104868944-104868966 CTCTATGCTCAGAGAACTGAAGG - Intronic
1058704524 9:107627607-107627629 CTTGAAACTCAGAGAGGTGAAGG - Intergenic
1058850818 9:109010872-109010894 CTAAAAGCTCAGAGAAGGCATGG - Intronic
1059257725 9:112945982-112946004 CTCTAAGTTCTGAGGGGGAAAGG + Intergenic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059422619 9:114201648-114201670 ACTGAAGCTCAGAGAGGGGAAGG - Intronic
1059683023 9:116604791-116604813 GTCTAAGGTCTGAGATGGGATGG + Intronic
1059694493 9:116718007-116718029 CTATAAGCTCTGTGAGGGCAGGG - Intronic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060484568 9:124039041-124039063 GGGTAAGCTCAAAGAGGGGAAGG + Intergenic
1060554631 9:124501919-124501941 CTCTCAGCCCAGAGAGGAGGAGG - Intronic
1060663646 9:125419662-125419684 CTCTGAGCTCAGTTAGGGAAGGG - Intergenic
1060942257 9:127549799-127549821 CTCTAAGCTCAGCGAGCAGCAGG + Intronic
1061512935 9:131071813-131071835 CTCTAAGCTCAGTGAGGATGGGG + Intronic
1062212406 9:135372144-135372166 CTCTAAGTTCACAGAGGAGAAGG - Intergenic
1203775547 EBV:71184-71206 CTCTAGGGTCAGAGAGGCCAGGG + Intergenic
1186163692 X:6804830-6804852 CTCCCAGTTCAGAGAGGAGAAGG + Intergenic
1188380127 X:29481467-29481489 TTCTAAGCTCAGAGAGCCAACGG + Intronic
1188930464 X:36103463-36103485 CACTCAGCTCACAGAGGGCAAGG - Intronic
1189163788 X:38838711-38838733 CACTACCCTCAGAGAGGGGAAGG + Intergenic
1189305805 X:39985782-39985804 CCTTGAGCTCAGAGAAGGGAGGG + Intergenic
1190338188 X:49275653-49275675 CTGTAAGCTCCGTGAGGGGTAGG + Intronic
1190444910 X:50514801-50514823 CTCCAATCTCAGAGCGGGGTTGG - Intergenic
1194496100 X:94619110-94619132 ATCTATGCTCAGAGGAGGGAAGG + Intergenic
1194825279 X:98554381-98554403 CCCTGAGTACAGAGAGGGGAAGG + Intergenic
1195406787 X:104523122-104523144 CTCTAAGCTCCGTGATGGTAAGG - Intergenic
1195575950 X:106450820-106450842 CTCAAAACTCAGAGAAGGGAAGG - Intergenic
1195979910 X:110566719-110566741 CTCTTATCTCAGAGTAGGGAAGG - Intergenic
1196759629 X:119189874-119189896 CTGTAAGCTCAGAGCTTGGAAGG - Intergenic
1198183394 X:134231929-134231951 CTATAAGCTCCAAGAGGGCAGGG - Intergenic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1202282185 Y:23200969-23200991 ATATAAACTGAGAGAGGGGAGGG - Intergenic
1202283706 Y:23217550-23217572 ATATAAACTGAGAGAGGGGAGGG + Intergenic
1202433857 Y:24815354-24815376 ATATAAACTGAGAGAGGGGAGGG - Intergenic
1202435382 Y:24831936-24831958 ATATAAACTGAGAGAGGGGAGGG + Intergenic