ID: 1184232997

View in Genome Browser
Species Human (GRCh38)
Location 22:43168591-43168613
Sequence CCTGCGGTGCAGAGTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184232997_1184233009 24 Left 1184232997 22:43168591-43168613 CCCTCCAGACTCTGCACCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1184233009 22:43168638-43168660 CTTTCCCCAACCCAGATTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 269
1184232997_1184233004 0 Left 1184232997 22:43168591-43168613 CCCTCCAGACTCTGCACCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1184233004 22:43168614-43168636 CACTTCCTGTGGGCCAAGCCAGG 0: 1
1: 0
2: 3
3: 39
4: 311
1184232997_1184233005 1 Left 1184232997 22:43168591-43168613 CCCTCCAGACTCTGCACCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1184233005 22:43168615-43168637 ACTTCCTGTGGGCCAAGCCAGGG 0: 1
1: 0
2: 3
3: 17
4: 229
1184232997_1184233002 -10 Left 1184232997 22:43168591-43168613 CCCTCCAGACTCTGCACCGCAGG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1184233002 22:43168604-43168626 GCACCGCAGGCACTTCCTGTGGG 0: 1
1: 0
2: 3
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184232997 Original CRISPR CCTGCGGTGCAGAGTCTGGA GGG (reversed) Intronic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
902407277 1:16191668-16191690 CCTGCTCTGCAGAGACTGTAGGG - Intergenic
902813808 1:18904703-18904725 CCTGGAGTGGGGAGTCTGGAGGG - Exonic
905923936 1:41736693-41736715 CATCCAGTACAGAGTCTGGAAGG - Intronic
906803776 1:48760107-48760129 CTTGCTGAGGAGAGTCTGGAAGG - Intronic
907317735 1:53583271-53583293 CCTGGGCTGCAGAGTTTTGATGG - Intronic
916040090 1:160954319-160954341 TCTGCTGTGCAGGGCCTGGAGGG - Intronic
919796655 1:201325171-201325193 CCTGCTGTGCAGGGTGAGGAGGG - Intronic
921791409 1:219294722-219294744 CCTGAGGCACAGACTCTGGATGG + Intergenic
922507272 1:226133804-226133826 GCTGTGCTGCAGAGACTGGATGG + Intergenic
924615066 1:245605821-245605843 CCTGCTGTGCAGAGTTGGGGCGG - Intronic
1063120960 10:3105441-3105463 CCTCTGGTGGAGATTCTGGAAGG - Exonic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066676458 10:37892843-37892865 CCTGCGGTCAGGAGTCTGGGAGG + Intergenic
1067225629 10:44374147-44374169 CCTGGGGAGCAGGGTCTGCAGGG - Intronic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1069861728 10:71475778-71475800 CCTGAGGGGCGGAGGCTGGAAGG + Intronic
1073063097 10:100743910-100743932 CCTGCGGGGTAAAGTCTGGGAGG - Intronic
1074259795 10:111840410-111840432 TTTACGGTGCACAGTCTGGACGG + Intergenic
1076425196 10:130362776-130362798 CAGGAGGTGAAGAGTCTGGAAGG - Intergenic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1078320965 11:10334206-10334228 CCTGTGCTACAGAGGCTGGAAGG - Intronic
1082698671 11:56401827-56401849 CCTGGGCTGCTGAGTCTGGTGGG - Intergenic
1086049873 11:82577439-82577461 CCTGCTGTGGAGAGTCCAGATGG + Intergenic
1089642952 11:119859620-119859642 CCTGGGGTGCTGAGGCTGGCTGG + Intergenic
1091302251 11:134515111-134515133 CGTGCGGGGCAGAGGCGGGAGGG - Intergenic
1101403051 12:104404853-104404875 CCTGCGGTGCTGAGTCCTGATGG - Intergenic
1106120084 13:26852835-26852857 TCTGCGCTGAAGAGTCTGGAAGG + Intergenic
1108640403 13:52378089-52378111 CTTGCGGATCAGAGTCTGGCTGG + Exonic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1111293077 13:86193517-86193539 CCTGTAGTGCAGAGTCAGGGAGG - Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1117868419 14:60172984-60173006 CCTGCGCTGCAGGGACAGGAAGG - Intergenic
1119745395 14:77040263-77040285 ACTGCGGTGAATAGTGTGGAGGG + Intergenic
1121021596 14:90583621-90583643 GCTGCAGGGCAGGGTCTGGAAGG + Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121357400 14:93227401-93227423 CCTGCGGAGGAGGTTCTGGAAGG - Exonic
1121778900 14:96609079-96609101 CCTGAGGTGTAGAGTTTGGGAGG + Intergenic
1122309467 14:100785395-100785417 ACTGCTGGGCAGAGTCAGGAAGG - Intergenic
1122323566 14:100869354-100869376 CCTGCTGTGTGGAGCCTGGAGGG + Intergenic
1122323753 14:100870396-100870418 CCTGCTGTGTGGAGCCTGGAGGG + Intergenic
1123131302 14:105987745-105987767 CCTGCAGTGCAAGGTCTGGGTGG - Intergenic
1125679321 15:41520949-41520971 CCCTCGGTGCAGAGCCTGGGAGG + Exonic
1127023971 15:54782048-54782070 CCTCCGTTGCCGAGGCTGGACGG - Intergenic
1127646947 15:60968232-60968254 CCTGCTGAGCTGACTCTGGAAGG + Intronic
1131959530 15:97773788-97773810 CCTGCGATGGAGAGTCTTGGAGG + Intergenic
1132672159 16:1106381-1106403 GCTGCCTGGCAGAGTCTGGATGG + Intergenic
1132783642 16:1642330-1642352 CCTGCTGTGCTGGGACTGGAGGG - Intronic
1132861520 16:2074025-2074047 TCTGCTGTGCAGAGTCTGCTCGG + Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1134656244 16:15949996-15950018 CCTGCGGAGCAGAGCGTGGGGGG + Intronic
1136421664 16:30138126-30138148 CCTGCGCTGCAGTGGCAGGAGGG + Intergenic
1141545078 16:84761456-84761478 CATGCGGAGCAGAGTCAGGAAGG + Intronic
1142014111 16:87734805-87734827 CCTGCGGTGCCAAGCCCGGAGGG - Intronic
1144759228 17:17698058-17698080 CCTGCAGTCCAGAGACTAGAGGG + Intronic
1147996322 17:44362228-44362250 CCTGAGGTGCAGGGACTTGAGGG + Intronic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148126848 17:45241661-45241683 GATGCGGGGCAGGGTCTGGAGGG + Intronic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1152082490 17:78196886-78196908 CCTGGGGTTCAGGGACTGGAGGG + Intronic
1152677074 17:81647138-81647160 GGTGCTTTGCAGAGTCTGGAAGG - Intronic
1158243000 18:55398567-55398589 CATGCTGTGCAGGCTCTGGAAGG - Intronic
1160583658 18:79901238-79901260 CCTGGGCTGCAGGGTCTGGTGGG + Intergenic
1160802484 19:976814-976836 CATGGGATGCAGAGTCTGTAGGG + Intergenic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1161501921 19:4620930-4620952 CCTGCTGTCCAGGGTCTGGGGGG + Intergenic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164960067 19:32420303-32420325 GCTGCTGTGAAGAATCTGGATGG + Intronic
1165797392 19:38526903-38526925 CCTGGGGTGCTGGGCCTGGAAGG + Intronic
1166181629 19:41113050-41113072 CCTGCGGTCAAGGGTCTGGGAGG - Intergenic
924968532 2:101111-101133 CCTGGGTTGCAGAGTCCTGATGG - Intergenic
925063374 2:910517-910539 CCTGGGGTGCAGAGGCTGTTGGG - Intergenic
927072038 2:19540848-19540870 CCTGAGGGACAGAGTCTGCAAGG - Intergenic
927194294 2:20537211-20537233 CCTGGGGTGCAGGGTCTGGATGG - Intergenic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
931244287 2:60479607-60479629 CAGGCGGTGGAGAGTGTGGACGG + Intronic
934855048 2:97724451-97724473 CCTGGGGCGCGGGGTCTGGAGGG + Intronic
936231260 2:110701123-110701145 TCTGCAGTGCAGGGTCTGGGTGG - Intergenic
938092365 2:128441916-128441938 CTTGGGGTTCACAGTCTGGAGGG + Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
940546104 2:155087777-155087799 ACTGTGGTCAAGAGTCTGGATGG + Intergenic
947982287 2:234420693-234420715 CTTGCAGTGCAGAGGCTGCAAGG + Intergenic
1173036058 20:39411973-39411995 AATGAGGTGCAGAGGCTGGAGGG + Intergenic
1173649739 20:44655583-44655605 ACTAAGGTGCAGAGGCTGGAGGG - Intergenic
1175473334 20:59249935-59249957 ACTGGAGTGCAGAGTCTGAATGG + Intronic
1175520033 20:59596727-59596749 CCTGCTGAGCAGAGCTTGGAAGG - Intronic
1175971212 20:62687639-62687661 CTTGGGGCGCAGAGTCTGGCTGG - Intergenic
1176194789 20:63831903-63831925 CCCGGGGTGCGGGGTCTGGAAGG + Intergenic
1178868153 21:36347736-36347758 ACTGTGCTGCAAAGTCTGGAAGG + Intronic
1180131624 21:45830441-45830463 CCTGCTGTCCATAGTCTGGCAGG - Intronic
1181671661 22:24428137-24428159 CCTGCGCTGATGAGTTTGGAAGG + Intronic
1182714728 22:32348398-32348420 CCTTCTGTGCTGAGTCTGGTGGG + Intergenic
1183516840 22:38271952-38271974 CCTGCGCTGCAGAGTCAGCCAGG - Intronic
1184227005 22:43134847-43134869 CTTGGGCTCCAGAGTCTGGAAGG - Intronic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184239619 22:43205275-43205297 CCTCCGGAGCAGTCTCTGGAGGG + Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184927069 22:47650480-47650502 CGTGCGGGGCAGAATCTGGATGG - Intergenic
1185181696 22:49367242-49367264 CCTGCAGTGCAGGGGCAGGAAGG - Intergenic
950047699 3:9959839-9959861 CCTGCAGTGTAGAGTATGAAAGG - Intergenic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
950905846 3:16537129-16537151 CCTGGGGAGCACAGTCTGCAAGG - Intergenic
951802659 3:26613559-26613581 ACTGCTGTGCAGAGAATGGAAGG + Intergenic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
955352480 3:58204073-58204095 TCTGCGATGCAGTGACTGGAGGG + Intronic
956744542 3:72301080-72301102 CCTGCTGTGCAGACTCTTGGGGG - Intergenic
958100072 3:88998249-88998271 CCTGGGGTCCAGATTATGGATGG - Intergenic
959358144 3:105358098-105358120 CCTGTTGTGCACAATCTGGATGG + Intergenic
961549756 3:127662320-127662342 CCTGCGGTTCGGAGCCTGGCTGG - Intronic
961610316 3:128132245-128132267 CCTGCGGTGATGAGGCTGGCCGG - Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962237114 3:133716066-133716088 ACTGAGGTGCAGTGTCAGGAGGG - Intergenic
967084930 3:186085963-186085985 GCTGCAGTGCGGAGTCTGGGTGG - Intronic
970314048 4:14812463-14812485 CCTGCTGGGAATAGTCTGGATGG - Intergenic
976186768 4:82449825-82449847 GCTGGGGTGAGGAGTCTGGAAGG - Intronic
977506725 4:97911764-97911786 CCGGCTGTGGAGAGTCTGGGCGG + Intronic
977827586 4:101551973-101551995 GCTTCAGTGCAGAGTCTGGCCGG + Intronic
979396560 4:120196489-120196511 CCTGCAGTGAAGAGTCTGGATGG - Intergenic
981001790 4:139835440-139835462 CCATAGGTTCAGAGTCTGGAAGG - Intronic
981937896 4:150254193-150254215 CCTGCGGTGCAGACTTGAGAAGG + Intronic
985344445 4:188988342-188988364 TCTGCGGTGCTGATTCAGGAAGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
989534836 5:42551336-42551358 GTTGCGGTGGGGAGTCTGGAAGG + Intronic
997434540 5:133864907-133864929 CGAGGGGTGCAGAGTCTGGAGGG + Intergenic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1002927366 6:1612049-1612071 CGTGCGGTACAGAGACTGGCTGG - Exonic
1003497695 6:6678753-6678775 CCAGGGGTGCAGAGTCTGAAGGG - Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1007689515 6:43690537-43690559 CTTGCGGGGTAGTGTCTGGAAGG - Intergenic
1010451919 6:76013248-76013270 GGTGGGGTGCAGATTCTGGAGGG - Intronic
1018321752 6:162617977-162617999 CCTGAGGTGCAGAGATTTGAAGG + Intronic
1018463677 6:164022801-164022823 CCTGCTGTTCAGAGCCTGCATGG + Intergenic
1018876435 6:167826556-167826578 CGCGCGGTGCAGAGTCCGGACGG - Intergenic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1029617166 7:101666214-101666236 CCCGGGATGCAGACTCTGGATGG - Intergenic
1031291677 7:119945510-119945532 TATGTTGTGCAGAGTCTGGAAGG + Intergenic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1034098542 7:148431683-148431705 CCTGTGGTTTGGAGTCTGGATGG - Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1037582338 8:20253082-20253104 GCTGCGCTGCAGCTTCTGGAGGG + Exonic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1045009154 8:97942965-97942987 CCTGCGATTCAGAGTCCAGAGGG - Intronic
1045370238 8:101515622-101515644 CCCGCAGTGCAGAGGTTGGATGG + Intronic
1045903661 8:107315957-107315979 CCTGTGGGACAGAGTCTGGCAGG - Intronic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1048073328 8:131042312-131042334 CCCGGGGTGCAGGGTCTGCAGGG + Exonic
1048197784 8:132346752-132346774 CCTGCAGGACAGAGTCTGGGAGG + Intronic
1049178075 8:141206230-141206252 TCTTGGGTGCAGAGTCTGGGCGG + Intergenic
1049191545 8:141290766-141290788 CCTACGGTCCAGAGACTGCAGGG + Intronic
1049312489 8:141940604-141940626 CCTGCGCTTCTGCGTCTGGAAGG - Intergenic
1049637103 8:143694922-143694944 CATGGGGTGCAGAGCCAGGAAGG - Exonic
1061099912 9:128484693-128484715 GCTGCGCTCCAGATTCTGGAAGG - Exonic
1061839032 9:133347186-133347208 CCTGCCGCGCAGAGACTGGAGGG - Exonic
1062385130 9:136306266-136306288 GCTGAGGTGCAGGGTCTGAATGG - Intronic
1192573044 X:72222005-72222027 CCTGGGGTGGAGGGTTTGGAAGG - Intronic
1193956779 X:87873561-87873583 CCTGAGGTGTACAGTCTGGTGGG + Intergenic
1194160060 X:90438323-90438345 CCTGAGGTGGACAGTCTGGTGGG + Intergenic
1200506354 Y:4015276-4015298 CCTGAGGTGGACAGTCTGGTGGG + Intergenic