ID: 1184233284

View in Genome Browser
Species Human (GRCh38)
Location 22:43169701-43169723
Sequence GCCTCCTGTTTGGACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184233284_1184233294 28 Left 1184233284 22:43169701-43169723 CCCTCAGGGTCCAAACAGGAGGC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1184233294 22:43169752-43169774 ACTGTGTGACTCTGGACCAACGG 0: 1
1: 0
2: 3
3: 29
4: 167
1184233284_1184233290 -6 Left 1184233284 22:43169701-43169723 CCCTCAGGGTCCAAACAGGAGGC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1184233290 22:43169718-43169740 GGAGGCAGGAGATGGAGTCTGGG 0: 1
1: 0
2: 2
3: 75
4: 677
1184233284_1184233289 -7 Left 1184233284 22:43169701-43169723 CCCTCAGGGTCCAAACAGGAGGC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1184233289 22:43169717-43169739 AGGAGGCAGGAGATGGAGTCTGG 0: 1
1: 0
2: 7
3: 96
4: 905
1184233284_1184233291 1 Left 1184233284 22:43169701-43169723 CCCTCAGGGTCCAAACAGGAGGC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1184233291 22:43169725-43169747 GGAGATGGAGTCTGGGCTCCAGG 0: 1
1: 1
2: 10
3: 63
4: 511
1184233284_1184233293 20 Left 1184233284 22:43169701-43169723 CCCTCAGGGTCCAAACAGGAGGC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1184233293 22:43169744-43169766 CAGGTCTTACTGTGTGACTCTGG 0: 1
1: 0
2: 14
3: 245
4: 2583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184233284 Original CRISPR GCCTCCTGTTTGGACCCTGA GGG (reversed) Intronic
900718565 1:4160513-4160535 GGCTTCTGTGTGGACCCAGAGGG - Intergenic
900887919 1:5428633-5428655 GCCTCCTGTTCTGCGCCTGAGGG + Intergenic
902343391 1:15799144-15799166 GCCTTCTGATTGGGCCCTCAGGG - Intergenic
903593770 1:24478562-24478584 GTCTCCTGACTTGACCCTGATGG - Intergenic
904468762 1:30723233-30723255 GCCTCATGCATGGTCCCTGAGGG + Intronic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
905311868 1:37054750-37054772 GCATCTTGTTTGTAACCTGAAGG - Intergenic
907287979 1:53394220-53394242 GCTTCAGGATTGGACCCTGAGGG + Intergenic
912163900 1:107019622-107019644 GTCTGCTGCTTGAACCCTGAAGG + Intergenic
916001816 1:160623795-160623817 GCATCCTGTGTTTACCCTGATGG + Intronic
918230817 1:182529569-182529591 GCCTCCTGTTTTGTCACAGATGG + Intronic
920016069 1:202909976-202909998 GTTTCCTGTTGGGACCCTAAAGG + Intronic
920338272 1:205259285-205259307 GCCTGCTGTGGGGACCCTAACGG + Intronic
921129049 1:212203689-212203711 GGCTCAAGTCTGGACCCTGAAGG + Intergenic
921202892 1:212824018-212824040 GTCTCCCATTTGGTCCCTGAGGG - Intergenic
922173560 1:223177561-223177583 GCCTGGCCTTTGGACCCTGAGGG - Intergenic
922729693 1:227943085-227943107 GCCTCCCTCTTGGACCCTGCGGG + Intronic
923273625 1:232378788-232378810 GCCCCCTGCCTGGTCCCTGAAGG - Intergenic
1065841543 10:29705418-29705440 CCTTTCTGTATGGACCCTGATGG - Intronic
1066604320 10:37145006-37145028 TCCTCTTGTTTGGATTCTGATGG - Exonic
1068776244 10:60871598-60871620 GCCCCCTGTGTGGTACCTGAAGG - Exonic
1068796746 10:61091328-61091350 GCCTGCTGTTTGGAGAATGAAGG - Intergenic
1069279567 10:66638016-66638038 GCCTACCCTTTGGACCCTGATGG + Intronic
1069804667 10:71112826-71112848 GCCTCCTTGTTGGCCTCTGATGG + Intergenic
1070064309 10:73018493-73018515 GCCTGTTGTTTGGGCCCTGTGGG - Intronic
1071601482 10:86960564-86960586 GCCTCCTGCTGGGAGCCTCAGGG + Intronic
1071960326 10:90803805-90803827 GCCTCCTGTTCGTACCATTATGG - Intronic
1072553872 10:96499504-96499526 GTCTCCTAACTGGACCCTGATGG + Intronic
1073320399 10:102612978-102613000 TGCTCTTGTTTGGGCCCTGAGGG + Intronic
1075207349 10:120458407-120458429 GCCTCCTGTTTGGCTCGGGAGGG - Intronic
1075417305 10:122274225-122274247 GCCCACTCTTTGGCCCCTGAGGG - Intronic
1076240415 10:128900830-128900852 GCCTCCTGGTTGGGGCCTGAAGG + Intergenic
1076364396 10:129912389-129912411 GCCTCCTGATTGGCTCCTGCAGG + Intronic
1076617282 10:131763888-131763910 TCCTCTTCTTTGCACCCTGAGGG - Intergenic
1081219401 11:40441213-40441235 GGCTCCTGTTGGGTCACTGAAGG + Intronic
1086788759 11:91007399-91007421 GCCTGCTGCCTGAACCCTGAAGG - Intergenic
1088301980 11:108367609-108367631 TCCTCGTATTTGGACCTTGAAGG + Exonic
1088401327 11:109424171-109424193 TCCTCCTGTTTGGACACAGCTGG + Exonic
1089077662 11:115751300-115751322 GCCTCCTATTTGGATGCAGAAGG + Intergenic
1089195634 11:116692678-116692700 GCCACCTGCCTGGACCCTCACGG - Intergenic
1091587092 12:1822542-1822564 GCCTCCTGAGTGGCCCCTCATGG - Intronic
1092054273 12:5496091-5496113 GACTCCTGTTGGGACTCAGAAGG - Intronic
1093170887 12:15859137-15859159 GTCTCCTGATTAGACCCTGGAGG + Intronic
1094160202 12:27382060-27382082 GCTTCCTGTTGGGAGCATGATGG + Intronic
1096409054 12:51364355-51364377 GCCTCCTGGTTGGGGCCTGCAGG - Exonic
1096548770 12:52358890-52358912 CCCAGCTGTTTGGGCCCTGAGGG - Intergenic
1096919973 12:55073076-55073098 GTTTCCTCTTTGGACTCTGAAGG + Intergenic
1097356963 12:58612775-58612797 ACCTCCTGCTTGTACCTTGAAGG + Intronic
1099296115 12:80830073-80830095 TTCTCCTGTTTGGACCTTCATGG - Intronic
1101875338 12:108593558-108593580 GGCTCCTGCTTGGAGCCTGGGGG - Intronic
1108576232 13:51794042-51794064 GCCTCCTGTTTTGCCTCAGAGGG - Intronic
1110372142 13:74751940-74751962 GTCCGCTGTTTGAACCCTGAAGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1116444272 14:44990472-44990494 CTCTCCTGTTTGGACTCAGAGGG + Intronic
1117951196 14:61083868-61083890 GTTTCTTGTTGGGACCCTGATGG + Intergenic
1118746838 14:68780462-68780484 GCCACCAGTTTGGAGGCTGAAGG - Intergenic
1118890015 14:69901200-69901222 CCCTTCTCTTTGGACCCTCATGG - Intronic
1123121825 14:105920294-105920316 GGCTCCTGCTGGGACCCTCAAGG - Intronic
1124208335 15:27742189-27742211 GCCTTCTGGTTGGGCCTTGATGG + Intergenic
1124570185 15:30855881-30855903 GTCTTCTGCTTGGCCCCTGAGGG - Intergenic
1126171736 15:45700919-45700941 GCTTCCTGTTGGGACCCCGGCGG + Intergenic
1126486498 15:49187455-49187477 GCCACCTGCTTGGGCCTTGAGGG - Intronic
1128747544 15:70125153-70125175 GCCTCCTGTCTGTGCCCAGAAGG + Intergenic
1131218530 15:90560780-90560802 GGCTCCTGATTGCACCCTGCAGG + Intronic
1132375023 15:101323229-101323251 GCCACCTGTGGGGGCCCTGAGGG - Intronic
1136554673 16:31000987-31001009 AGCTCCTGTTTGGTCTCTGAGGG + Exonic
1138389293 16:56658470-56658492 GCCTCCTGTTTGCACTCCAAAGG - Intronic
1139549940 16:67667496-67667518 GCTTTCTCTTTGGACCATGACGG - Exonic
1140741919 16:77949111-77949133 GCCTCCTGTTTGTTCTCTGAAGG - Intronic
1141759069 16:86015377-86015399 GCCTCCTGGTTGGACAGAGAAGG + Intergenic
1141943025 16:87290938-87290960 GCTTCCGGCCTGGACCCTGAAGG + Intronic
1142247537 16:88976819-88976841 GGCTCCAGGTTGGCCCCTGAGGG - Exonic
1142803993 17:2362113-2362135 GCCTCCTGGCTGACCCCTGAGGG - Exonic
1142864331 17:2781194-2781216 GCCTCCTTCTTGGACCATGCTGG + Intronic
1143174434 17:4948210-4948232 TGCTCCGGTTTGGACCCTGAGGG - Intronic
1147748283 17:42709675-42709697 GCCTCCTGAGTGCTCCCTGAGGG - Intronic
1149328379 17:55556124-55556146 GCCTCCTGTGTGGACCAGGGTGG - Intergenic
1149656169 17:58310639-58310661 GCCTCCTGCTTGGCCAGTGAGGG + Exonic
1151391752 17:73791818-73791840 GCCTCCTGTGTGTCCCCAGACGG - Intergenic
1152081609 17:78190948-78190970 GCCTCATGTTTGTGCCCTGCAGG + Exonic
1152889796 17:82873986-82874008 GCCTCCTGTTGGCCCCGTGAGGG + Intronic
1155904353 18:31430826-31430848 GCTTTGTCTTTGGACCCTGAAGG + Intergenic
1156838810 18:41587002-41587024 CCCTCCTGTTGTGACCATGATGG + Intergenic
1157692125 18:49692152-49692174 GCATCCTGGCTGGGCCCTGAAGG + Intergenic
1159098720 18:63936255-63936277 GCCTTCTGTGCGGACCCGGAAGG - Intergenic
1160599728 18:80003344-80003366 GCCTGCTGCCTGGACCCAGAGGG + Intronic
1164464909 19:28479489-28479511 CCCACCTGGTTGGAGCCTGAAGG - Intergenic
925312703 2:2897209-2897231 GCCTGCTGCTTGGACCTGGAGGG + Intergenic
926296065 2:11569725-11569747 CCCTGCTGTTTGAACCCCGAGGG + Intronic
927686916 2:25177639-25177661 GACTCTGCTTTGGACCCTGAGGG - Intergenic
929039871 2:37734025-37734047 GCCTTCTGTGGGGAGCCTGAGGG - Intronic
929402178 2:41596898-41596920 GCCTGCTGTTAGGATCCTCATGG - Intergenic
932163188 2:69481614-69481636 GCCTCATGATTGGACCCTCCTGG + Intronic
934524760 2:95044817-95044839 GCCTCCTGTGTGCACCTTGCTGG - Intronic
935732322 2:106074237-106074259 GCCTCCTGAATGTACCCTGGTGG - Intronic
937250273 2:120519435-120519457 GCCGCCTGTCAGGACCCTGCTGG + Intergenic
939832619 2:147090813-147090835 GCTTCCTCTTTGCAACCTGATGG - Intergenic
941720046 2:168802925-168802947 GCCTCATATTTGGATCCAGATGG + Intronic
943228703 2:185215625-185215647 GCCTGCAGTCTGAACCCTGATGG + Intergenic
944350195 2:198717648-198717670 GCCTCCTGTGTGGTCCCTTATGG - Intergenic
945186198 2:207142313-207142335 GACACCTGTTTGAACTCTGATGG + Intronic
947587013 2:231362547-231362569 ACCTCTGGGTTGGACCCTGAGGG - Intronic
1168829609 20:838422-838444 TCCTCGTGTTTGGTCCCTGAAGG + Intronic
1169468455 20:5862312-5862334 GTCTGCTGCTTGAACCCTGAAGG + Intronic
1173119587 20:40276509-40276531 GCCTCCAGTTTGGAACAGGAAGG + Intergenic
1174343664 20:49914451-49914473 GTCTCCTGTTTGGAGGCTGATGG - Intronic
1179883539 21:44303656-44303678 GCCTCCTGTTTGGAGCCTTCAGG + Intronic
1180041325 21:45281853-45281875 GCCTCCTGGGTGGACCCTCGAGG + Intronic
1180244470 21:46537806-46537828 GCCTCCTGCTTGGTCCCAGGAGG - Intronic
1181689212 22:24549080-24549102 GCCTCCTGCCTAGACCCTGCAGG + Intronic
1183164947 22:36140568-36140590 GTCCCCTGCTTGAACCCTGAAGG - Exonic
1183171164 22:36189365-36189387 GTCCCCTGCTTGAACCCTGAAGG - Exonic
1183431020 22:37765811-37765833 GCCTCAGGTATGGACCCTGGGGG + Exonic
1183499328 22:38169009-38169031 GCCTCGTGCTGGGACACTGATGG + Intronic
1184098266 22:42328352-42328374 GCCACATGCCTGGACCCTGAGGG - Intronic
1184233284 22:43169701-43169723 GCCTCCTGTTTGGACCCTGAGGG - Intronic
1184866453 22:47204328-47204350 GCGGCCTGTTTGGATGCTGATGG - Intergenic
1203292156 22_KI270736v1_random:5596-5618 GCCTTCTGTGGGGAGCCTGAGGG - Intergenic
949787220 3:7755137-7755159 GGCTCATGTGTGGACTCTGAAGG + Intergenic
952153016 3:30612986-30613008 GCCTCCTGCTTAGACTCTTAAGG + Intronic
952505454 3:34003286-34003308 GCATCCTGTCACGACCCTGAGGG - Intergenic
952525174 3:34202635-34202657 TTTTCCTGATTGGACCCTGAGGG - Intergenic
955943552 3:64169548-64169570 GCCTCCTTTTCAGACCCAGAGGG - Intronic
958904859 3:99930724-99930746 GCCTTCTGTTTGAAGCATGATGG + Intronic
958943316 3:100337390-100337412 ATGTCCTGTCTGGACCCTGATGG - Intronic
963967953 3:151394658-151394680 GGCTCCAGATTGGACCCTGCAGG + Exonic
970781373 4:19741900-19741922 GTTTCCTGTTTGGCCCCTCATGG + Intergenic
980419580 4:132542465-132542487 ACCTCCTGTTTGTCCCCTTAGGG - Intergenic
981599718 4:146472632-146472654 GCCTCCTGTGCAGACCCTGGTGG + Intronic
992643440 5:78790106-78790128 ACCTACTGTTGTGACCCTGAAGG + Intronic
992872312 5:81019279-81019301 GCCTCACTTTTGGGCCCTGATGG + Intronic
997474711 5:134136189-134136211 GCAGCCTGTTTGTACCCTGATGG + Intronic
997654994 5:135547954-135547976 GCCTCTTCTCTGGACACTGAGGG + Intergenic
998883640 5:146671418-146671440 GATTCCTGTCTGGACACTGAAGG + Intronic
999333051 5:150690945-150690967 ACCTCCTGCTGGGACTCTGATGG - Exonic
1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG + Intergenic
1004980499 6:21018057-21018079 GCCTCCTGATTGACCCCTGCTGG - Intronic
1013306704 6:108854319-108854341 GTCTTCTGCTTGGACACTGAAGG - Exonic
1018360778 6:163065393-163065415 GCCTCCTGGTTTCACTCTGATGG - Intronic
1018957269 6:168418664-168418686 GACTCCTGCTTGGACCCCCAAGG + Intergenic
1019145726 6:169974220-169974242 GCCCACTGTGTGGACACTGAAGG + Intergenic
1022033346 7:26512467-26512489 GGCTCCTGTCTGGACGCTGGGGG + Intergenic
1024734544 7:52290352-52290374 GTTCCCTGTTTGTACCCTGAAGG + Intergenic
1028720365 7:94023561-94023583 GCTTCCTGTTGAGAACCTGAAGG - Intergenic
1032642037 7:133780737-133780759 GCCACCTGTTTGGATTCTCATGG - Intronic
1034891162 7:154840325-154840347 TCCTCCTCTTTAGCCCCTGATGG - Intronic
1034922023 7:155091191-155091213 GCTTCCTGTTTGGCCACCGACGG + Intergenic
1037445352 8:18959914-18959936 GCCTCATGTTTCCAGCCTGAGGG - Intronic
1037950694 8:23017283-23017305 GCCACCTGTGTGGTACCTGAAGG + Exonic
1038224080 8:25638638-25638660 GACTCCTGTAGGGACCCTGAAGG - Intergenic
1038226621 8:25663890-25663912 GTCTCCTATTTGGTCCCTGAGGG - Intergenic
1038697255 8:29817617-29817639 CACTCCTGTTTGGCTCCTGAGGG - Intergenic
1047067029 8:121296428-121296450 GCTTCCTGCTGAGACCCTGATGG - Intergenic
1048461159 8:134623028-134623050 GCCTCCTGTTGGTACCCTGATGG + Intronic
1049622853 8:143606367-143606389 GCCTCAAGGTTGGACTCTGAGGG + Intronic
1051911498 9:22157325-22157347 GCCTCCTGTCTGGTCCTTAATGG - Intergenic
1053132193 9:35622251-35622273 GCCACCTGATTGCACCATGAGGG + Intronic
1053814543 9:41893844-41893866 ACCTGCTGTGTGCACCCTGATGG + Exonic
1054616053 9:67293596-67293618 ACCTGCTGTGTGCACCCTGATGG - Intergenic
1058562284 9:106242854-106242876 CCTTCCTGGTTGTACCCTGATGG - Intergenic
1060275582 9:122179863-122179885 GCTTCCTGTTGGCATCCTGAAGG + Intronic
1061792187 9:133064629-133064651 GCCACCTGCAGGGACCCTGAAGG + Exonic
1062116935 9:134814606-134814628 AGCTCCTGTGTGCACCCTGAGGG - Intronic
1185545142 X:937576-937598 CGCTCTTGTTTGGACACTGACGG - Intergenic
1185642252 X:1594919-1594941 GCCTCGTGTTTTGACCGTGTTGG + Intronic
1187396361 X:18922971-18922993 GGCTTCTGTTTGGTCCCTGATGG - Intronic
1191604950 X:63051087-63051109 ACCTTCTGTGTGGACTCTGAGGG - Intergenic
1193193688 X:78604550-78604572 CCCTCCTTTTTGGACCTTAAAGG - Intergenic