ID: 1184235013

View in Genome Browser
Species Human (GRCh38)
Location 22:43178675-43178697
Sequence CGAGGCACTTAGTGAGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184235004_1184235013 22 Left 1184235004 22:43178630-43178652 CCACTCTCACATGGGTCAACTCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1184235006_1184235013 -6 Left 1184235006 22:43178658-43178680 CCCTTCCCGAAACCCTCCGAGGC No data
Right 1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1184235001_1184235013 30 Left 1184235001 22:43178622-43178644 CCACGCGCCCACTCTCACATGGG 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1184235007_1184235013 -7 Left 1184235007 22:43178659-43178681 CCTTCCCGAAACCCTCCGAGGCA 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55
1184235003_1184235013 23 Left 1184235003 22:43178629-43178651 CCCACTCTCACATGGGTCAACTC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184235013 Original CRISPR CGAGGCACTTAGTGAGCGCC TGG Intronic
902874438 1:19332376-19332398 CCAGGCACTTACTGTGTGCCAGG - Intergenic
913192756 1:116427115-116427137 CGAGGCACTGAGTAAGGGCCAGG - Intergenic
923689124 1:236176038-236176060 ATAGGCACTTAGTGGGAGCCCGG + Intronic
1063381880 10:5590779-5590801 GGAGGCAGTTAGGGAGGGCCTGG - Intergenic
1072241201 10:93496844-93496866 CCAGGCACGAAGTGAGCGCCAGG - Exonic
1072456298 10:95579289-95579311 CTTGGCACTTAGTGAGTGCTTGG + Intergenic
1076880881 10:133238495-133238517 CGAGACTTTCAGTGAGCGCCCGG - Intronic
1077429875 11:2511122-2511144 GGAGGCACGTAGTGTGTGCCTGG - Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1084110848 11:67013435-67013457 CCAGGAACTGAGTGAGCGTCTGG + Intronic
1084934850 11:72581358-72581380 CGAGGTAGTTGGTGAGCTCCAGG + Exonic
1090278672 11:125437585-125437607 CCAGGCACATAGTGGGCACCCGG - Intergenic
1090901268 11:131033786-131033808 CCTGGCACTTAGTGAGTGCTGGG - Intergenic
1091831019 12:3551307-3551329 CGAGGCACTTGCTGAGGGCAGGG + Intronic
1098625913 12:72667481-72667503 CAAGGCACTTAGTGAGGGAAAGG + Exonic
1099852540 12:88120114-88120136 TGAGGCACTTAGAGAGCGTGTGG - Exonic
1102206723 12:111096070-111096092 CGAGCCACTTGTTGAGCCCCTGG - Intronic
1103158788 12:118710199-118710221 AGAGAGACTGAGTGAGCGCCAGG + Intergenic
1105996584 13:25678334-25678356 AGAGGCACTTAGTGACAGGCTGG + Intronic
1118272305 14:64354874-64354896 CTAGTCACTTAGTGAGCATCTGG + Intergenic
1122890739 14:104731052-104731074 GGAGGCAGGTAGAGAGCGCCAGG + Intronic
1124634310 15:31355203-31355225 GGAGACACTTACTGAGCACCTGG - Intronic
1139323008 16:66130487-66130509 TAAGGCACTGAGTGAGCACCAGG - Intergenic
1139511721 16:67431658-67431680 CGAGCCAAATAGGGAGCGCCGGG + Intronic
1144890169 17:18489864-18489886 CGAGTCCCTAAGTGAGTGCCAGG - Intronic
1147360895 17:39928865-39928887 AGAGGCACTTAGTGGTCACCAGG + Intergenic
1152656558 17:81522563-81522585 ACAGGCACTTAGGGAGTGCCAGG - Intronic
1157815562 18:50727399-50727421 GGAGGCACTGAGGGAGGGCCAGG + Intronic
1161069638 19:2253671-2253693 CCAGGCACTTGTTGAGCGACAGG + Exonic
1167881857 19:52465780-52465802 CGAGGCACTCAGAGAAAGCCAGG - Intronic
1168385032 19:55956090-55956112 CGAAGCACTTACTCAGAGCCAGG - Exonic
928203437 2:29266745-29266767 CGAAGCACCTACTGAGTGCCAGG - Intronic
929885024 2:45870846-45870868 CTGGGCACATAGTGAGCGCTTGG + Intronic
942416939 2:175769578-175769600 TGAGGCAATGAGTGAGGGCCTGG + Intergenic
1174076404 20:47940516-47940538 AGCGGCACTTAGTGAGCACTTGG + Intergenic
1181456607 22:23063582-23063604 GGAGGCACTCAGTGACCGCTGGG + Intronic
1183369241 22:37423163-37423185 CGAGGCACTGTGGGAGGGCCAGG + Intronic
1184235013 22:43178675-43178697 CGAGGCACTTAGTGAGCGCCTGG + Intronic
1185415311 22:50706142-50706164 CGAGGAACTTGGTGAGTGGCGGG + Intergenic
949944531 3:9179451-9179473 CTTGGCACTTAGTAAGCACCTGG + Intronic
950363153 3:12464011-12464033 TGAGGCCCTTAGTCAGTGCCAGG - Intergenic
968868139 4:3227035-3227057 AGAGGCACCCAGTGAGCCCCAGG - Intronic
979775374 4:124583062-124583084 GGAGGCAGTGAGTGAGCTCCGGG + Intergenic
987957921 5:24764060-24764082 CGAGGAACTGATTGAGAGCCAGG - Intergenic
997669024 5:135655265-135655287 GGAAGCACTTAGAAAGCGCCTGG - Intergenic
1000292132 5:159880335-159880357 TGTGGCACTTAGTAAGTGCCTGG - Intergenic
1001403103 5:171458075-171458097 TTAGGCACTTACTAAGCGCCAGG + Intergenic
1001630156 5:173168948-173168970 AGAGGTACTGAGTGAGCTCCTGG - Intergenic
1002640138 5:180626829-180626851 CGAGGCAGGCAGTGAGAGCCAGG - Intronic
1002707374 5:181171028-181171050 CGAGGCAGTTAGTGTTCCCCAGG - Intergenic
1015928707 6:138335139-138335161 CGAGACACTGAGGGAGCTCCCGG - Exonic
1019749637 7:2720927-2720949 CCAGGCACTTCGTGAGCCCGAGG - Intronic
1048302075 8:133259246-133259268 AGAAGCCATTAGTGAGCGCCCGG + Intronic
1049216044 8:141408896-141408918 CAAGGCACTCTGTGAGGGCCGGG - Intronic
1057508096 9:95653015-95653037 CAAGGCAGTGAGTGAGTGCCTGG + Intergenic
1060484584 9:124039118-124039140 AGGGACACTTAGTGAGTGCCAGG + Intergenic
1061165600 9:128920442-128920464 GTAGGCACTTACTCAGCGCCAGG + Intergenic
1062447809 9:136602983-136603005 CTGGGCACTTTGTCAGCGCCAGG - Intergenic