ID: 1184235669

View in Genome Browser
Species Human (GRCh38)
Location 22:43181854-43181876
Sequence GTGGGTGACCACGTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184235664_1184235669 20 Left 1184235664 22:43181811-43181833 CCTGTCCTAAAATAAGTGGGTTT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG No data
1184235665_1184235669 15 Left 1184235665 22:43181816-43181838 CCTAAAATAAGTGGGTTTACTCT 0: 1
1: 0
2: 4
3: 15
4: 158
Right 1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184235669 Original CRISPR GTGGGTGACCACGTGATGCA GGG Intronic
No off target data available for this crispr