ID: 1184238105

View in Genome Browser
Species Human (GRCh38)
Location 22:43197085-43197107
Sequence CGCAGGGGGCGCCCACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184238105_1184238112 19 Left 1184238105 22:43197085-43197107 CCTAAATGTGGGCGCCCCCTGCG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1184238112 22:43197127-43197149 CTCGCTGCTTTATTTTCCAGAGG 0: 1
1: 0
2: 0
3: 30
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184238105 Original CRISPR CGCAGGGGGCGCCCACATTT AGG (reversed) Intergenic
906047683 1:42844755-42844777 AGCAAGGCCCGCCCACATTTGGG + Exonic
918451547 1:184664186-184664208 CGCAGCGAGCGCCCTCACTTCGG - Intergenic
1064174236 10:13060366-13060388 CTCAGGGAGCGCCAGCATTTGGG + Intronic
1088976102 11:114817772-114817794 CGAAGGGGGCTCCCACAATCAGG + Intergenic
1108254575 13:48598180-48598202 CTCAGGAGGGCCCCACATTTTGG + Intergenic
1113618635 13:111698324-111698346 CGCATTGGGGTCCCACATTTGGG - Intergenic
1113624164 13:111783585-111783607 CGCATTGGGGTCCCACATTTGGG - Intergenic
1123006211 14:105325050-105325072 GGCAGGGGGTGCCCACAGCTTGG - Intronic
1125507427 15:40274831-40274853 AGCAGGGGGCGTCCACAGTAAGG - Intronic
1132646080 16:999889-999911 CCCTGGGGGTGCCCACACTTTGG + Intergenic
1132852808 16:2032569-2032591 CCCAGGGGGCACCCAAAGTTGGG - Intronic
1140446800 16:75035748-75035770 CGCAGTGGCCGCCAACACTTGGG + Intronic
1144283830 17:13752847-13752869 CTCAGTGGTTGCCCACATTTGGG - Intergenic
1148572876 17:48684705-48684727 CGCAAGAGGACCCCACATTTTGG + Intergenic
1173138100 20:40458071-40458093 CTCAGAGGGAGCCCACTTTTTGG + Intergenic
1180228417 21:46412061-46412083 CGCGGGGGGAGCCCACCTGTGGG - Exonic
1184238105 22:43197085-43197107 CGCAGGGGGCGCCCACATTTAGG - Intergenic
1184781858 22:46653645-46653667 CGTAGGGGGCAGCCCCATTTAGG + Intronic
963881472 3:150533382-150533404 AGAAGGGGGCTCCCACCTTTCGG - Intergenic
969485624 4:7471025-7471047 CGCAGGCAGCCCCCTCATTTGGG - Intronic
971370183 4:26012804-26012826 CTCAGGGGACCCCCAGATTTAGG + Intergenic
975622395 4:76307474-76307496 AGCAGGAGGCGCCCGCAGTTCGG - Intronic
986667768 5:10118084-10118106 TGCGGGGGGTGCCCACTTTTGGG - Intergenic
990922126 5:60979353-60979375 CTCATGGGGCCCCCACTTTTAGG + Intronic
1001431329 5:171664958-171664980 GGCAGGGGGCACCCTGATTTTGG - Intergenic
1001580709 5:172796439-172796461 TGCAAGGGACCCCCACATTTGGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1029550385 7:101234281-101234303 CGCAGGGGCCCTCCACATTCTGG - Exonic
1034273747 7:149815282-149815304 CCCAGGGGGCACCCACAAGTGGG - Intergenic
1037785861 8:21902913-21902935 CGGAGGGGGCGCCAGCATTTAGG - Intergenic
1038695940 8:29806216-29806238 GGCAGGGGGCTTCCACAGTTGGG - Intergenic
1040598472 8:48862251-48862273 CGCAGGTGGAGCCCAGCTTTGGG + Intergenic
1187412195 X:19061236-19061258 CTGAGGGGGGGCCCACTTTTTGG + Intronic
1187959859 X:24558169-24558191 GGCAGGGGGCGCGCAGAGTTGGG + Intronic
1190360490 X:49644456-49644478 CTCAGGGAGCACCCACATCTGGG + Intergenic
1190732847 X:53236131-53236153 AGCAGGGGGAGCCCAGCTTTTGG - Intronic
1193359915 X:80569874-80569896 AGCAGGAGACACCCACATTTTGG + Intergenic
1195617958 X:106927889-106927911 CGCAGGAGGCGATGACATTTTGG + Intronic
1201295191 Y:12456128-12456150 CGCACGGTGCCCCCACATCTAGG - Intergenic