ID: 1184244629

View in Genome Browser
Species Human (GRCh38)
Location 22:43229702-43229724
Sequence CCACCCATAAAGGTCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184244624_1184244629 8 Left 1184244624 22:43229671-43229693 CCACACAGGTAAAAAGAGAAGAG 0: 1
1: 0
2: 1
3: 39
4: 384
Right 1184244629 22:43229702-43229724 CCACCCATAAAGGTCAAAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184244629 Original CRISPR CCACCCATAAAGGTCAAAAA GGG Intronic
903987143 1:27236413-27236435 GCTCCCATATAGGTCAAAAAAGG - Intronic
904019038 1:27448125-27448147 CCGCCCCTAAGGCTCAAAAAAGG - Intronic
904438598 1:30515309-30515331 CAGCCCAGAAAGGTCAAACAAGG + Intergenic
909354210 1:74688642-74688664 CCACATAAAAAGGTCTAAAAAGG + Intergenic
910517192 1:88075163-88075185 CCACCCCTGAAGGACCAAAACGG - Intergenic
912705610 1:111909792-111909814 CATCTCATAAAGGTGAAAAAAGG - Intronic
916815428 1:168347306-168347328 CCATCCATAAAGGCAAAAGATGG - Intergenic
917957596 1:180116338-180116360 CCCCACATAACGGTCAACAATGG + Intergenic
921531791 1:216291794-216291816 CCAGACATAAAGGACAATAAAGG + Intronic
923824183 1:237480949-237480971 GCACTCATAAAGCTCCAAAAAGG - Intronic
924281068 1:242438015-242438037 ACTCCCATAAAGGTAAAAAATGG - Intronic
1063507497 10:6614072-6614094 CCACCCATCAAGCCCAAAGAAGG - Intergenic
1063572842 10:7232165-7232187 CAACCCTTACAGGTCCAAAAGGG + Intronic
1065761762 10:28989234-28989256 CCACCAATAAAGCTGAAAACAGG - Intergenic
1069517581 10:69090918-69090940 ACACCCATAAAGAAAAAAAATGG + Intronic
1073648211 10:105329253-105329275 CCAGCATTAAAGTTCAAAAATGG - Intergenic
1074218674 10:111413754-111413776 AAACCTATCAAGGTCAAAAATGG + Intergenic
1079966418 11:26985570-26985592 TCAGCAATAAAGGTCAAATAAGG + Intergenic
1081085591 11:38796344-38796366 CCAGCCATAAAGGAAAAAGAAGG - Intergenic
1084508304 11:69585018-69585040 CCACCAATAAGGGGCAAAACAGG - Intergenic
1087127589 11:94642510-94642532 CCCCCCAGAAAGGTGAAGAAGGG - Intergenic
1088176799 11:107062062-107062084 CCAATCATAAAGATTAAAAAGGG + Intergenic
1091145880 11:133279799-133279821 CTACCCATAAAGAATAAAAAAGG + Intronic
1091430870 12:433155-433177 CCACCTAGACAGGCCAAAAAGGG - Exonic
1093353636 12:18135326-18135348 CCTCCCATAAAGTCCAAATAAGG - Intronic
1095835051 12:46628715-46628737 CCACCCCTAAGGGTCAGAACAGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1100211000 12:92398724-92398746 ACACCCATCAAGTTCAAAGAGGG + Intergenic
1101769109 12:107732140-107732162 CCACCCAAAATGGGCAGAAAAGG + Intergenic
1103179669 12:118899200-118899222 CCACCCAAAAAGCTCATAACGGG - Intergenic
1107281392 13:38739404-38739426 CTTCCCATAAAAGTCAAAAGAGG - Intronic
1107375790 13:39802723-39802745 CCAACCAGAAATGCCAAAAATGG + Intergenic
1110683567 13:78345430-78345452 CTATCCATAAATGTCAACAATGG - Intergenic
1113095511 13:106659956-106659978 TCACCAATAAAGTACAAAAAGGG - Intergenic
1115671970 14:35623538-35623560 CAAGCTATAAAGGTTAAAAAAGG + Intronic
1117977101 14:61309699-61309721 CCACCCCAAAAGGTCATGAATGG + Intronic
1118954007 14:70463005-70463027 CCTCTCACAAAGGTCATAAATGG + Intergenic
1123114160 14:105886390-105886412 CCACCCAGAAAGGTCAGATGTGG + Intergenic
1123116378 14:105895998-105896020 CCACCCAGAAAGGTCAGATGTGG + Intergenic
1123118378 14:105905039-105905061 CCACCCAGAAAGGTCAGATGTGG + Intergenic
1125074633 15:35599257-35599279 CCGCCCATCAAGGACAGAAAAGG - Intergenic
1125364565 15:38900274-38900296 CCACTCTTAAAGGTCCAAATAGG - Intergenic
1126210569 15:46097005-46097027 CCAAACATAAAGCACAAAAAAGG - Intergenic
1131803137 15:96093181-96093203 CCACCTATTAAGGAAAAAAATGG + Intergenic
1132682718 16:1149931-1149953 CCACCGAGAAAGGACATAAACGG - Intergenic
1133907071 16:10032005-10032027 CCACCCAGGAAGGTCAGAGAAGG - Intronic
1141123234 16:81379215-81379237 CCACCCATAGACATAAAAAAGGG + Exonic
1146075729 17:29726786-29726808 TCACCCAGCAGGGTCAAAAAAGG + Intronic
1148137931 17:45307550-45307572 CCACCCCAAAAGGTTAAATAAGG - Intronic
1148463675 17:47851812-47851834 TCACCCAGAAAGGTCAGAGAGGG - Intronic
1148821012 17:50359666-50359688 CCACCAATGATGGTCAAGAAAGG + Intronic
1150522001 17:65878487-65878509 CCAACCATAAAGACAAAAAATGG + Intronic
1153157732 18:2168056-2168078 CCAGCCATAAAACTGAAAAATGG + Intergenic
1154192973 18:12245769-12245791 CCACCCAGCAGGGTCAAAAGAGG + Intergenic
1155341938 18:24821978-24822000 CCACCCACCATGGTCTAAAAAGG - Intergenic
1163284023 19:16335111-16335133 CCACGAATAAAGTTTAAAAAAGG - Intergenic
1163322473 19:16582724-16582746 CCTCCCAGGGAGGTCAAAAAAGG + Intronic
1163594884 19:18215273-18215295 CCAGCCAAAGAGGTCAGAAAGGG - Intronic
1167262584 19:48467443-48467465 CCACTCATAAAGGTCAGTGAGGG + Intronic
1167569259 19:50276745-50276767 CCCCCAATAAAGGTCCAAGAGGG + Exonic
1168261047 19:55194828-55194850 TTACCCATAATGGTCAAAAGTGG + Intronic
1168345923 19:55650155-55650177 CCACCCAAAAAGGCCCACAAAGG - Intronic
925364182 2:3300092-3300114 CCATTCTTATAGGTCAAAAAGGG + Intronic
927165237 2:20313394-20313416 ACAACCAAAAAGGTCAATAAAGG + Intronic
927241583 2:20924179-20924201 TCACACATAAAGGTCAACCAAGG - Intergenic
928580692 2:32704695-32704717 AAACCCATCAAGGTCAAAAAAGG - Intronic
929737593 2:44566728-44566750 CCACTCATAAATGTCAAGCAGGG - Intronic
933629770 2:84642615-84642637 CCACTGAAAAAAGTCAAAAAAGG - Intronic
939788085 2:146540868-146540890 CCTCCCTTAAAGCTCACAAATGG - Intergenic
944387229 2:199180330-199180352 CCCCCCAGAAAGGTGGAAAAGGG - Intergenic
1168779853 20:479399-479421 TCACCAAAAAAGGGCAAAAAGGG + Intronic
1171333088 20:24358415-24358437 CCACCTATAAAGGTGAATGATGG + Intergenic
1171865395 20:30485062-30485084 CCACCACTAAAAGTCATAAAAGG + Intergenic
1171952167 20:31429768-31429790 CCACAAAAAAAGGTAAAAAAGGG - Intergenic
1173156186 20:40611971-40611993 CCACCCTTAACGGTAAAACAAGG + Intergenic
1177452407 21:21287965-21287987 TCACCCATAGATGTCAAGAAAGG - Intronic
1184244629 22:43229702-43229724 CCACCCATAAAGGTCAAAAAGGG + Intronic
1185117894 22:48948547-48948569 CCACCCACTAAAGTCATAAAAGG - Intergenic
952160948 3:30692402-30692424 CAACCCATGAAGGTAAAAAGTGG - Exonic
957258907 3:77875180-77875202 GCCCCCACAAAGGACAAAAAAGG + Intergenic
962111610 3:132456309-132456331 CAACCCATAAAGGTCAGCGATGG + Exonic
963456894 3:145555974-145555996 CCCCCCAGAAAGGTGAAGAAGGG + Intergenic
964236721 3:154539318-154539340 ACACCCAAAAACCTCAAAAAAGG - Intergenic
965960336 3:174422044-174422066 CCACCCATCAAGGGAAAGAATGG - Intergenic
966304695 3:178518215-178518237 CTACCCAGGAAGGTCAAAAAGGG + Intronic
967794075 3:193579409-193579431 CCACCCCTAAAAGCCAAAATGGG - Intronic
972451364 4:39202477-39202499 CCACCCTGATAGGTGAAAAATGG - Intronic
973809695 4:54557847-54557869 CAATACTTAAAGGTCAAAAAGGG - Intergenic
973828291 4:54731816-54731838 ACAACCATAAAGGTCAGGAAAGG - Intronic
974283921 4:59838880-59838902 CCACCAATAATGGGAAAAAAAGG - Intergenic
974652794 4:64776957-64776979 TCTCCCAGAAAGGTCAAAAAGGG + Intergenic
977782657 4:100996506-100996528 CCCCCCAGGAAAGTCAAAAAGGG + Intergenic
978801418 4:112758963-112758985 TCACCTATAAAGGTCCTAAAAGG - Intergenic
981648938 4:147033992-147034014 CCACCAGTAAAAGTTAAAAAAGG + Intergenic
984445022 4:179825744-179825766 CCACCGATGTGGGTCAAAAAAGG + Intergenic
990614288 5:57491329-57491351 CCAACCAGAAAGGAAAAAAAGGG + Intergenic
992115642 5:73536225-73536247 CCACTCTTAAAAGTCAAAGAAGG + Intergenic
995751921 5:115460969-115460991 CCATTTATATAGGTCAAAAATGG + Intergenic
999477100 5:151910568-151910590 CCATGCAGAAAAGTCAAAAATGG - Intronic
1001452032 5:171834095-171834117 CCACCCAGAGAGGTTAAAAAAGG + Intergenic
1007905468 6:45455601-45455623 GCACCCGTAAAGGTCCATAAAGG + Intronic
1008967932 6:57333488-57333510 CAACCCAAAAAAGTGAAAAAAGG - Intronic
1010071121 6:71747480-71747502 CTACCCATTAAGGTGAACAAAGG + Intergenic
1012823994 6:104124764-104124786 CCAACTATCAAGGACAAAAAAGG - Intergenic
1013815956 6:114097857-114097879 CTACCCCTAAAGGACAAAAATGG + Intronic
1015355387 6:132271964-132271986 CCACCCCTAAAAGCCAAAATGGG + Intergenic
1015700785 6:136033998-136034020 CCACAGATAAGGGTCAATAAGGG + Intronic
1016026460 6:139292340-139292362 CTACCCAAAAAGGACAACAATGG - Intergenic
1016509221 6:144821357-144821379 CCCCCCATAAGGGGAAAAAAAGG - Intronic
1018846268 6:167558993-167559015 CCACCCATAAAAGGCAACTAGGG + Intergenic
1021295301 7:18898090-18898112 CCACCAAGAAATGTCTAAAATGG - Intronic
1021390851 7:20090832-20090854 AAACCAACAAAGGTCAAAAAAGG + Intergenic
1025831152 7:65051340-65051362 CAACCCAGAAAGGGAAAAAATGG - Intergenic
1025918301 7:65885221-65885243 CAACCCAGAAAGGGAAAAAATGG - Intronic
1027485368 7:78754964-78754986 CCATCCGTCAAGGTGAAAAAAGG - Intronic
1030131561 7:106206117-106206139 CCATTTATAAAGGTCAAAAATGG + Intergenic
1030282832 7:107794684-107794706 CCACCTTTTAAGATCAAAAAAGG + Intronic
1032018636 7:128394655-128394677 CCACCTCTTAAGGGCAAAAACGG + Intronic
1036788308 8:11702280-11702302 CGACCCTTAAAGGGCGAAAAGGG - Intronic
1036976671 8:13420793-13420815 GCCACTATAAAGGTCAAAAATGG - Intronic
1038621198 8:29144626-29144648 CTACCCACACAGGTCACAAATGG - Intronic
1040054122 8:43042696-43042718 ACACATATAAAGTTCAAAAATGG + Intronic
1040728342 8:50411102-50411124 CTACCCAAAAAGGCCAAACAAGG - Intronic
1043511026 8:80950435-80950457 CTACCCATAAATGGCTAAAAAGG - Intergenic
1044171191 8:89053757-89053779 CTATCCCTAAAGGTCAAAGAAGG - Intergenic
1045354180 8:101370567-101370589 CAACCCAAATAGGTCAAAATGGG + Intergenic
1046206490 8:111005448-111005470 TCATCCATAAAGTTCAAATAAGG + Intergenic
1047580690 8:126212224-126212246 CCATCCATAGAGGTCCTAAAGGG - Intergenic
1048867226 8:138770020-138770042 CCACCCCTAAATGTCAAGTATGG + Intronic
1055981848 9:82011507-82011529 CCACACAGAAAGGTCAAAGTGGG + Intergenic
1058909510 9:109507880-109507902 ACACCCAAGAAGGTGAAAAATGG - Intergenic
1060702496 9:125769688-125769710 GCACACATAAAGGGAAAAAAAGG + Intronic
1186096634 X:6109613-6109635 CAATCCAAAAAGGTCAAACAAGG + Intronic
1190540146 X:51468901-51468923 CCACAAACAAAGGTCAAAAATGG - Intergenic
1191099939 X:56715232-56715254 AAACCCACAAAGATCAAAAAAGG + Intergenic
1192597985 X:72431672-72431694 CCTCTCATCAAGGTCAACAATGG + Intronic
1193193685 X:78604546-78604568 ACACCCTTTAAGGTCCAAAAAGG + Intergenic
1193209957 X:78795847-78795869 TCAAACATAAAGGACAAAAAAGG - Intergenic
1193326162 X:80180677-80180699 ACACCCAAGAAGGACAAAAAAGG - Intergenic
1193389459 X:80909068-80909090 AAACCCATAAAGATCAAAAAAGG + Intergenic
1194675558 X:96789710-96789732 ACATTCATAAAGTTCAAAAAAGG - Intronic
1194759226 X:97774599-97774621 CCACCTATAAAAGACAAAACTGG + Intergenic
1196152346 X:112389050-112389072 CCAACCAAAAAGGAAAAAAAAGG - Intergenic
1199859518 X:151788909-151788931 CCAGCAAAAAAGATCAAAAAGGG - Intergenic
1202257318 Y:22935046-22935068 CCAGCCATAGTGGTCAAAACTGG - Intergenic
1202410309 Y:24568793-24568815 CCAGCCATAGTGGTCAAAACTGG - Intergenic
1202460473 Y:25101279-25101301 CCAGCCATAGTGGTCAAAACTGG + Intergenic