ID: 1184244743

View in Genome Browser
Species Human (GRCh38)
Location 22:43230301-43230323
Sequence CCACTTGTGTGGAGCCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184244722_1184244743 26 Left 1184244722 22:43230252-43230274 CCAGCCCCATCTGAACTCCCCTC 0: 1
1: 0
2: 6
3: 58
4: 422
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244728_1184244743 8 Left 1184244728 22:43230270-43230292 CCCTCCCCTCCTAGGAGCCACCC 0: 1
1: 0
2: 1
3: 37
4: 421
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244727_1184244743 9 Left 1184244727 22:43230269-43230291 CCCCTCCCCTCCTAGGAGCCACC 0: 1
1: 0
2: 3
3: 54
4: 525
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244724_1184244743 21 Left 1184244724 22:43230257-43230279 CCCATCTGAACTCCCCTCCCCTC No data
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244731_1184244743 4 Left 1184244731 22:43230274-43230296 CCCCTCCTAGGAGCCACCCTGGC No data
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244723_1184244743 22 Left 1184244723 22:43230256-43230278 CCCCATCTGAACTCCCCTCCCCT 0: 1
1: 0
2: 4
3: 86
4: 869
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244735_1184244743 -1 Left 1184244735 22:43230279-43230301 CCTAGGAGCCACCCTGGCAGGTC No data
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244733_1184244743 2 Left 1184244733 22:43230276-43230298 CCTCCTAGGAGCCACCCTGGCAG 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244736_1184244743 -9 Left 1184244736 22:43230287-43230309 CCACCCTGGCAGGTCCACTTGTG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244729_1184244743 7 Left 1184244729 22:43230271-43230293 CCTCCCCTCCTAGGAGCCACCCT 0: 1
1: 0
2: 1
3: 16
4: 317
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244721_1184244743 27 Left 1184244721 22:43230251-43230273 CCCAGCCCCATCTGAACTCCCCT No data
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244725_1184244743 20 Left 1184244725 22:43230258-43230280 CCATCTGAACTCCCCTCCCCTCC No data
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1184244732_1184244743 3 Left 1184244732 22:43230275-43230297 CCCTCCTAGGAGCCACCCTGGCA 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184244743 Original CRISPR CCACTTGTGTGGAGCCCAAG GGG Intronic
901659362 1:10788989-10789011 CCACTGCAGGGGAGCCCAAGGGG + Intronic
902971927 1:20060011-20060033 CTCCTTGTGTGCAGCCCTAGTGG - Intronic
909694935 1:78456655-78456677 CGACTTGTGTGGAGCTAATGAGG + Intronic
910820283 1:91338222-91338244 CACCCTGTGTGGAGCCCAAAGGG + Intronic
913714907 1:121523704-121523726 CTAAGTGGGTGGAGCCCAAGGGG + Intergenic
917517373 1:175719237-175719259 ACCCCTGTGTGCAGCCCAAGAGG - Intronic
918800698 1:188967277-188967299 CCTATTGTGTGGAGCACAATAGG - Intergenic
919729509 1:200903871-200903893 ACCCTTGTATGGAGCCCAAGGGG - Intronic
920560808 1:206937152-206937174 CTACCTGTGTGGAGCCCATTCGG - Exonic
1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG + Intronic
1067905573 10:50287471-50287493 CCTCTGGTATGGAGCCCATGAGG + Intergenic
1071402865 10:85294505-85294527 CTACTTGGGTGGATCTCAAGGGG - Intergenic
1072517961 10:96204976-96204998 CCACCTGTGTGGAGGCCACATGG - Intronic
1076352962 10:129831376-129831398 CCGCATGTGTGGACCCCATGTGG + Intergenic
1083950926 11:65955682-65955704 CCCCTTGTATGAAGCCCCAGGGG - Intronic
1088621989 11:111694411-111694433 TCACTTGTCTTTAGCCCAAGAGG + Intronic
1088815409 11:113417324-113417346 GCACTTGTGTTGAGCCCATAAGG + Intronic
1091166342 11:133479685-133479707 CGACTTGGGTGGGGCCCAAATGG - Intronic
1094211810 12:27901080-27901102 ACACTGGTCTGAAGCCCAAGAGG + Intergenic
1096522904 12:52194166-52194188 CCCCTGGTGTGGGGCCCAAGAGG - Intergenic
1098087624 12:66864115-66864137 TCACATGTGTGGATCCCGAGTGG + Intergenic
1102248268 12:111368779-111368801 CCACTGGTGCGGAGTCCCAGCGG + Intronic
1103945012 12:124521089-124521111 CTACATGTGTGGGGCCCAGGGGG + Intronic
1104443684 12:128816180-128816202 CTACTTCAATGGAGCCCAAGCGG + Intronic
1112033329 13:95476189-95476211 AGACGTGTGTGGAGCTCAAGAGG + Intronic
1112656410 13:101456315-101456337 CCACGTTTGTGGGGCCCATGCGG + Intronic
1112691482 13:101900737-101900759 ACACTTGTGTGAAGACCATGCGG - Intronic
1113649657 13:112026690-112026712 GCTTTTCTGTGGAGCCCAAGAGG - Intergenic
1117248122 14:53907420-53907442 CTACTTGTGATGAGCCCCAGAGG + Intergenic
1128804767 15:70522430-70522452 CCACCTGTGGGGATCCCAGGAGG + Intergenic
1129335140 15:74847563-74847585 GCACTTGTTTGGAGGGCAAGGGG + Intronic
1130091249 15:80823255-80823277 CGACTTGTGTTTAGCTCAAGGGG - Intronic
1132748347 16:1446196-1446218 CCACTGGTGTGGAGGCAGAGGGG + Exonic
1136291851 16:29278131-29278153 CCAGCTGTGTGCAGCTCAAGAGG - Intergenic
1142047478 16:87934933-87934955 CCACAGGTGTGGACCCCAACAGG + Intronic
1142097743 16:88252091-88252113 CCAGCTGTGTGCAGCTCAAGAGG - Intergenic
1142863910 17:2779000-2779022 GCACATGTGTGGGGCTCAAGTGG + Intronic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1150980143 17:70132275-70132297 CCACTCTTGTGGACACCAAGTGG + Exonic
1153175535 18:2368021-2368043 ACACTTGTAAGGGGCCCAAGCGG - Intergenic
1160517218 18:79485197-79485219 CCACCAGTGTGCAGCCCACGGGG + Intronic
1160550699 18:79692242-79692264 CCATTTGTGTGAAGCCCCACTGG + Intronic
1162911493 19:13850294-13850316 CCACTTCTGGGGAGCCCCGGTGG + Intergenic
1168713165 19:58513095-58513117 TTACTTGTGGGGAGCCCAGGGGG - Intergenic
931239467 2:60439407-60439429 CCTCATCTGTGGAGCCCATGGGG + Intergenic
933580184 2:84117063-84117085 CTACTAGGGTGGAGCCTAAGTGG + Intergenic
935274736 2:101466424-101466446 CAGCTTGTGTGGTGCCAAAGCGG + Intronic
944621719 2:201522707-201522729 CAACCTGTGTGGAGCCCAGAGGG + Intronic
946704501 2:222445085-222445107 CCACTTCTGTGGAGCCCCCATGG + Intronic
946725666 2:222658716-222658738 CCATTTGTGATGAGCCCTAGTGG - Intergenic
1171335035 20:24376601-24376623 CCATTTGTATGAAGCCAAAGAGG - Intergenic
1172991543 20:39040534-39040556 AGACCTGTGTGGAGCCCGAGGGG - Intergenic
1174354443 20:49988668-49988690 TCACTTGTCGGGGGCCCAAGTGG + Exonic
1181377611 22:22472487-22472509 CCAATTGTGTTGAGCCATAGAGG + Intergenic
1181899190 22:26138763-26138785 CCTCCTGTGTGTAGCCCAGGTGG - Intergenic
1184059092 22:42071039-42071061 CCACCTCTGTGGGGACCAAGAGG + Intergenic
1184244743 22:43230301-43230323 CCACTTGTGTGGAGCCCAAGGGG + Intronic
954583504 3:51716259-51716281 CAGCTTGTGTGGATCCCAAGGGG + Intronic
956523414 3:70130626-70130648 CCACAGGTGTGCATCCCAAGAGG - Intergenic
961085602 3:124064800-124064822 CAACGTGTGTGTAGCTCAAGGGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
970373658 4:15434369-15434391 CCACTTTTGTGGTACCCATGGGG - Intronic
974450197 4:62045322-62045344 CAACATTTGTGGAGACCAAGAGG + Intronic
977191200 4:94003162-94003184 CCATTTGTTTGTATCCCAAGAGG - Intergenic
978125553 4:105131090-105131112 CCAGTGGGGTGGAGCCCAAAGGG - Intergenic
978376495 4:108079567-108079589 CCAGTTGTGTGGGGACCAGGAGG + Exonic
979146640 4:117254440-117254462 CCATCTGTGTGGAGCCCCACTGG + Intergenic
982428110 4:155290749-155290771 CCACTTGAATGGATCTCAAGGGG - Intergenic
989160024 5:38381747-38381769 CCACTTGTGTGCTGCCCATTAGG - Intronic
989962824 5:50436749-50436771 CTAAGTGGGTGGAGCCCAAGGGG - Intronic
990833206 5:59984096-59984118 CCATTTATGTGAAGTCCAAGAGG + Intronic
991482919 5:67102844-67102866 CCCCGTGTGTGGTGCACAAGTGG - Intronic
1002807583 6:591853-591875 CCACCTGTGTGGAGGCCCTGAGG - Intronic
1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG + Intergenic
1007589702 6:43013808-43013830 CCATTTGAGGGGAGCCCATGGGG - Exonic
1010540053 6:77082344-77082366 ACACCTCTGTGGAGCCCATGAGG + Intergenic
1012741918 6:103027919-103027941 CCCCTTGTGTGAAGCCCAGTAGG - Intergenic
1019118955 6:169788032-169788054 CCACATGCTTGGAGCCCCAGAGG - Intergenic
1019328339 7:450695-450717 CTACCTGTGTGGAGCCCACAGGG + Intergenic
1020342804 7:7131022-7131044 CCACATGAGAGGATCCCAAGCGG - Intergenic
1022069398 7:26897546-26897568 CAACTAATGTGGAACCCAAGAGG - Intronic
1030267025 7:107631331-107631353 CCACATGTCTGGAGCACAAACGG + Intergenic
1031690573 7:124782718-124782740 CCCCTTGTGTGAAGCCCCACGGG - Intronic
1031974361 7:128084550-128084572 CCTCTGGAGTGGAGACCAAGAGG + Intronic
1032187485 7:129739741-129739763 GCACTTGTGAGGAATCCAAGTGG - Intronic
1032909067 7:136408214-136408236 ACACTTGTGTGGTTCCCCAGGGG - Intergenic
1044721413 8:95152690-95152712 CTACTTTTGTGGAGGACAAGAGG + Intronic
1046366170 8:113235783-113235805 CCCCTTGTGTGAAGCCCAGCAGG + Intronic
1047754100 8:127905363-127905385 CCACCTGTGTGGTGCCCTGGGGG + Intergenic
1048364672 8:133728431-133728453 CCACTTGTCTAGACCTCAAGTGG - Intergenic
1050469314 9:5969325-5969347 CAACTTGTATGGAGACCATGTGG - Exonic
1052337098 9:27331236-27331258 CAACCTGTGCGGAGCCCCAGGGG - Intronic
1053618689 9:39794570-39794592 CCACTTGTGGGGAGTCCAACAGG - Intergenic
1053876866 9:42553932-42553954 CCACTGGTGGGGAGTCCAACAGG - Intergenic
1053895811 9:42740773-42740795 CCACTGGTGGGGAGTCCAACAGG + Intergenic
1054234832 9:62547790-62547812 CCACTGGTGGGGAGTCCAACAGG + Intergenic
1054265466 9:62912859-62912881 CCACTTGTGGGGAGTCCAACAGG + Intergenic
1055401840 9:75932494-75932516 CCAGTTGCGTGGGGACCAAGAGG + Intronic
1059326249 9:113505552-113505574 CCACATGTGTGGTGGGCAAGTGG - Intronic
1061570233 9:131473621-131473643 CCCCCTGTGTGGAGCCCAGAGGG + Exonic
1187280459 X:17854841-17854863 CTCCTTCTGAGGAGCCCAAGGGG + Intronic
1191603235 X:63033104-63033126 AAACTTGTGTGGAGCCCCAAAGG - Intergenic
1192637370 X:72832368-72832390 GAACCTGTGTGGAGCCCAAAAGG + Intronic
1192644344 X:72888446-72888468 GAACCTGTGTGGAGCCCAAAAGG - Intronic
1192932645 X:75824348-75824370 CAACCTGTGTGGAGCCCAGAGGG - Intergenic
1198256696 X:134930299-134930321 ACACTTGTGTGACACCCAAGTGG - Intergenic