ID: 1184245093

View in Genome Browser
Species Human (GRCh38)
Location 22:43231720-43231742
Sequence GCCATGCCCCGGGTGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184245093_1184245102 8 Left 1184245093 22:43231720-43231742 CCGAGAGCCACCCGGGGCATGGC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1184245102 22:43231751-43231773 ACCCTGGCAGGTGCGCTCGTCGG 0: 1
1: 0
2: 0
3: 4
4: 60
1184245093_1184245100 -8 Left 1184245093 22:43231720-43231742 CCGAGAGCCACCCGGGGCATGGC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1184245100 22:43231735-43231757 GGCATGGCAGGGGCTCACCCTGG 0: 1
1: 0
2: 4
3: 37
4: 570
1184245093_1184245101 -4 Left 1184245093 22:43231720-43231742 CCGAGAGCCACCCGGGGCATGGC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1184245101 22:43231739-43231761 TGGCAGGGGCTCACCCTGGCAGG 0: 1
1: 0
2: 2
3: 48
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184245093 Original CRISPR GCCATGCCCCGGGTGGCTCT CGG (reversed) Intronic
900548571 1:3242118-3242140 GCCAGGCCCCTGTGGGCTCTGGG + Intronic
901575584 1:10198279-10198301 GCTATGCCCCTGGAGGCTCTAGG + Intergenic
901919387 1:12525560-12525582 GCCTTGTCCCTGGCGGCTCTGGG + Intergenic
902068669 1:13712857-13712879 GCCATGCCCCCATTGTCTCTTGG + Intronic
902802937 1:18841658-18841680 GCCCTGCCCCTGGAGTCTCTAGG - Intronic
904306221 1:29592055-29592077 GCCAGGCACAGGCTGGCTCTCGG - Intergenic
904368770 1:30035283-30035305 CCAATGCCCTGGGTGGCTCCAGG - Intergenic
904831110 1:33307331-33307353 GCGGTGCCCCGCGTGGCGCTGGG - Exonic
906259908 1:44379001-44379023 GCCATGGGTCGGGTGGGTCTTGG + Intergenic
906556656 1:46719232-46719254 GCCCTGCCCCGGCTGGGGCTGGG + Intergenic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
915073666 1:153292423-153292445 GCCAGGGGCAGGGTGGCTCTGGG - Intergenic
915732548 1:158064530-158064552 GCAATGCTCCGGAGGGCTCTAGG - Intronic
921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG + Exonic
924423572 1:243931318-243931340 GTCATGCACGGGGTAGCTCTGGG - Intergenic
1067097189 10:43309520-43309542 GGCATGCCCAGGCTGGCTTTAGG - Intergenic
1067278965 10:44857099-44857121 GTCATGCCTCTGGTGGCTCAAGG - Intergenic
1067711968 10:48656809-48656831 GCCATGCTGCGTGTGGCTCTGGG - Intergenic
1067776101 10:49165904-49165926 GCCAGGCCCCGGGTCTCTCGAGG - Intronic
1068828686 10:61468667-61468689 GCCATGCCCCAGGTTTCTGTAGG + Intergenic
1070325892 10:75388815-75388837 GACATGCCCTGAGGGGCTCTGGG - Intergenic
1073433719 10:103503279-103503301 GTCATCCCCCGGATGGCTTTGGG + Intronic
1074087209 10:110217419-110217441 GACATGCCCAGGGCTGCTCTGGG + Intronic
1074974537 10:118569438-118569460 GCCAGGCACCGGGAGTCTCTGGG + Intergenic
1076526429 10:131115265-131115287 GCCCTGCCCCGAGGGGCTCCAGG - Intronic
1076536104 10:131178707-131178729 GCCCTGCCCCAGGTGTCTCCGGG + Intronic
1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG + Intergenic
1076647190 10:131961465-131961487 CCCATGGCCAGGGTGGCTGTAGG - Intergenic
1077486075 11:2838990-2839012 GCCCTGCCCGGGGTTGCACTAGG + Intronic
1077496826 11:2890642-2890664 CCCATGCCCCTGGGGCCTCTGGG - Intronic
1078508240 11:11967517-11967539 GCCATGCCCTGTGTGGCTGCAGG - Intronic
1083583204 11:63838679-63838701 TCGTTTCCCCGGGTGGCTCTCGG - Intergenic
1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG + Exonic
1085197880 11:74683340-74683362 GCTTTGCCCAGGGTGGCCCTGGG + Intergenic
1085517397 11:77119447-77119469 GCCGGGCCCTGGGAGGCTCTGGG + Intronic
1085711135 11:78830187-78830209 GAAATGCCCCGGGGGGTTCTAGG - Intronic
1091795103 12:3293622-3293644 GCCCTGCCCTGGACGGCTCTTGG - Intergenic
1092284553 12:7121291-7121313 GCCATGCCTCTGCTGTCTCTTGG + Intergenic
1092917167 12:13199357-13199379 GGCTTGCTCTGGGTGGCTCTAGG + Intronic
1094497100 12:30995277-30995299 TCCCTGCCCAGGGTTGCTCTGGG - Exonic
1095991064 12:48034912-48034934 ACCATGTGCAGGGTGGCTCTTGG - Intergenic
1101267108 12:103100551-103100573 GCCATTGTCCGGGTGGTTCTGGG - Intergenic
1103336629 12:120194772-120194794 GCCCTGCCCCCGCTGGCTCCCGG - Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104886891 12:132115684-132115706 GCCGTGCCCTCGCTGGCTCTGGG + Intronic
1106385575 13:29282272-29282294 GCCATGCTCCTGCTGGCTCTAGG + Intronic
1108690791 13:52857531-52857553 GCCATGCCCGGGAGGGCTCGCGG - Intergenic
1113453273 13:110428462-110428484 ACCTTGCCCCGGGTGTCCCTGGG - Exonic
1117953770 14:61107348-61107370 GCCAAGCCCCGAGTGTCTCCTGG + Intergenic
1117989547 14:61420246-61420268 GCCAGGCCCAGAGTGGCTCTGGG - Intronic
1118822174 14:69352712-69352734 GCCAAGCCCAGGGTGGCACTGGG + Intronic
1121096045 14:91218764-91218786 GCCAGGCCCAGGCTTGCTCTAGG + Intronic
1122896370 14:104759511-104759533 GCCATGCACGGCGTGGCTCCCGG - Exonic
1127450450 15:59111326-59111348 GCCAAGCCCTTGGTGGCTTTTGG + Intronic
1128612547 15:69085463-69085485 TGCATTCCCCTGGTGGCTCTGGG - Intergenic
1131394802 15:92077724-92077746 GCCATATCCCTGCTGGCTCTGGG - Intronic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1133762288 16:8808762-8808784 ACCGTGCCCCGGGTGACCCTAGG - Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1139699163 16:68696745-68696767 GACATCCACCAGGTGGCTCTTGG + Intronic
1141428868 16:83960710-83960732 GCCATCCCCCACGTGGTTCTGGG + Exonic
1141649805 16:85386866-85386888 GCCATTCCTGGGGTGCCTCTTGG + Intergenic
1141803343 16:86325274-86325296 GCCTGGCCCCAGGTGACTCTGGG + Intergenic
1141949447 16:87331248-87331270 GCCACATCCCGGGTGGCTCTGGG - Exonic
1142860163 17:2756145-2756167 GCCCTGCCCCGGGTGGCAGAAGG - Intergenic
1143116723 17:4585335-4585357 AACATGCCCCGCGTGGCTCCAGG - Intronic
1143880554 17:10026521-10026543 GCCATGCCCTGGCTGCTTCTGGG - Intronic
1147605170 17:41770326-41770348 TCCATCCCCTGGGTGGGTCTGGG + Intronic
1151144794 17:72030718-72030740 GCGATGCCCGGGAGGGCTCTGGG - Intergenic
1151361248 17:73590466-73590488 GCTCTGCCCCGTCTGGCTCTGGG + Intronic
1151672269 17:75577703-75577725 GCCTTGCCCTGGATGGCTGTGGG - Intergenic
1151995790 17:77608194-77608216 TCCAAGCCTCGGGTGGCTCGTGG + Intergenic
1152122310 17:78426361-78426383 GCCATGCTCCTGCAGGCTCTAGG + Intronic
1152321551 17:79610866-79610888 GCCATGCCCCGGCTGCATCCCGG + Intergenic
1152491434 17:80637250-80637272 CCCATGCCCAGCGTGGCTCTGGG + Intronic
1152563950 17:81091886-81091908 GCCAGGCCCCGGCCAGCTCTAGG - Intronic
1160011979 18:75112942-75112964 GCCATGCCCAGGGTGGATGGAGG + Intergenic
1160022318 18:75190309-75190331 AGCATGCCCCGTGTGGCCCTTGG + Intergenic
1160474502 18:79170218-79170240 CCCAGGCCCAGTGTGGCTCTGGG - Intronic
1160852548 19:1199870-1199892 TCCAGGTCCCTGGTGGCTCTGGG - Intronic
1161153489 19:2721170-2721192 GCCCTTCCCCGCGTGGCTCCGGG - Intronic
1161744740 19:6048989-6049011 GCCAATCACCGTGTGGCTCTGGG - Intronic
1162380587 19:10329451-10329473 CCCAAGCCCCAGGTGGCTTTGGG + Intronic
1162771113 19:12949799-12949821 GCTGTGCCCCAGTTGGCTCTGGG + Intronic
1163821490 19:19498916-19498938 GCCAGGCCCCGAGAGGCTCAGGG + Intronic
1165352244 19:35282144-35282166 GCCATGCCCCGTGTGCATGTAGG + Intronic
1165730159 19:38140098-38140120 GCCATGAACGGGGTGGCTCCAGG + Intronic
1166213173 19:41320226-41320248 GCCTTGCGCTGGGTGGCTCTGGG - Intronic
1166392036 19:42413774-42413796 GTCATCCCCCAGGTGGCCCTGGG + Intronic
926577358 2:14596828-14596850 GCCTTGCTCCTGGTGGGTCTGGG - Intergenic
926747250 2:16168961-16168983 GCCCAGCCCCGGGTTCCTCTCGG - Intergenic
928028492 2:27758983-27759005 GCCAGGCACCGTGTGGCTCATGG + Intergenic
928179778 2:29060586-29060608 GCCCTGCATCAGGTGGCTCTAGG - Exonic
931633880 2:64324950-64324972 GCCACGCCCCTGGTGGGTCGGGG + Intergenic
938400606 2:130987757-130987779 GCCAAGGCCAGGGTGGCTGTGGG + Intronic
940330236 2:152466258-152466280 GACATGCCCCTGATGGGTCTGGG + Intronic
944599546 2:201289603-201289625 GCTCTGCCCTGGATGGCTCTGGG - Intronic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
947341685 2:229146917-229146939 GTCATGCTCCCGGAGGCTCTAGG - Intronic
947674024 2:231961461-231961483 GCCAGGCGCCGGCTGGCTCCGGG - Intronic
948428278 2:237902202-237902224 GCCTTGCTCCGGGTGGCAGTGGG - Intronic
948678386 2:239612362-239612384 GCCATGGCCAGCGTGGCCCTGGG - Intergenic
948797390 2:240411983-240412005 GCCAAGTCCCTGGTGGCTCTGGG - Intergenic
948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG + Intronic
1171065031 20:22007172-22007194 CACATTCCCCGGATGGCTCTTGG - Intergenic
1173081362 20:39871085-39871107 GCCATGCCACTTATGGCTCTGGG + Intergenic
1173148636 20:40546958-40546980 GGCATGCCTTGGGTGCCTCTGGG - Intergenic
1175658609 20:60793133-60793155 GCCTTGCCCCCGGCGGCCCTGGG - Intergenic
1175989939 20:62783609-62783631 GCCATGCCCCGGCTCCCCCTGGG + Intergenic
1176151860 20:63595560-63595582 GCCATGGCCAGGGTGGGGCTGGG + Intronic
1179992177 21:44953781-44953803 GCCACCCCCCGGGGAGCTCTTGG + Intronic
1180049817 21:45326011-45326033 GCAAAGCCCCGGGAGGCTCTGGG + Intergenic
1180053927 21:45347354-45347376 GTCGTGCCCCGGCTGGCGCTGGG - Intergenic
1180732753 22:17994291-17994313 GCCATTCCCCTGGGGGCTCCAGG + Intronic
1183308236 22:37095416-37095438 GGCATCCCCTGGGTGACTCTTGG + Intronic
1183750761 22:39719123-39719145 GCCATGCCCTTGGTGGCTGCAGG - Intergenic
1183781699 22:40003089-40003111 GCCAGGCCCTGGGAGGCTCTTGG + Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184276647 22:43412547-43412569 GCCAAGCCCCTGCTGGCACTTGG + Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185277512 22:49956213-49956235 CCCAGGCCCCGGGTGGCTTATGG + Intergenic
950387814 3:12673780-12673802 TTCATGCTCCGGGTGGCCCTTGG - Intergenic
952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG + Intergenic
954683022 3:52355987-52356009 GCCAGGCCCTGGGAGGCACTAGG - Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
960326481 3:116302244-116302266 AGCATGCCTGGGGTGGCTCTAGG + Intronic
961371305 3:126433618-126433640 CCCATGCCCGGGGTGGCCCCAGG - Intronic
961599165 3:128045779-128045801 GCCATGCCCTGGATGTTTCTTGG + Intergenic
966687257 3:182709535-182709557 GCCCAGCCCCAGGTGGTTCTAGG + Intergenic
966920007 3:184604972-184604994 GCCAGCCCTCGGGTGGCTCTTGG + Intronic
967477310 3:189936861-189936883 GCCCTGCCCAAGCTGGCTCTGGG - Intergenic
969185175 4:5469325-5469347 GCACTGCCCTGGGTGGCCCTTGG - Intronic
969652849 4:8478015-8478037 GCCAGGCCCAGGATGGCTCCAGG + Intronic
970344560 4:15141007-15141029 GACATGAGCCGTGTGGCTCTGGG - Intergenic
973034714 4:45391201-45391223 TCCTGGCCCCGGGTGGCTCCTGG - Intergenic
975779079 4:77820000-77820022 GCCAGGCTCTGCGTGGCTCTCGG - Intergenic
982528127 4:156505505-156505527 TTCCTGCCCCGTGTGGCTCTCGG - Intergenic
985539869 5:482910-482932 GCCAGGCCGCGTGTGGCTCCGGG - Intronic
985619515 5:946800-946822 GCCATGCTGGGAGTGGCTCTGGG + Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
987749887 5:22026153-22026175 GCCATGCCTCTGATGGATCTGGG - Intronic
989480558 5:41925559-41925581 CCCAGGCCCCGGGGGGCTCCAGG - Intronic
990528812 5:56654015-56654037 GCCATCCACAGGGTGGCTGTGGG + Intergenic
990620205 5:57550657-57550679 CCCCTGCCCTGTGTGGCTCTCGG + Intergenic
998007299 5:138665513-138665535 GCCAGGCCCTGGGTGCCTCCCGG - Intronic
1001288883 5:170442558-170442580 GCCCTGCCCTGTCTGGCTCTGGG + Intronic
1001673107 5:173490853-173490875 TCCATGCCCCAGCTGTCTCTGGG - Intergenic
1001944828 5:175770392-175770414 GCCCTGCCCCTGCTTGCTCTAGG + Intergenic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1003218331 6:4135556-4135578 GCCATCCCTTGGGCGGCTCTAGG + Exonic
1003573126 6:7268929-7268951 GCCCTCCGCCGGATGGCTCTGGG - Intronic
1004217061 6:13712217-13712239 CCCAGGCCCCGGGGCGCTCTAGG + Intergenic
1010732223 6:79403402-79403424 CAGATGCCCAGGGTGGCTCTGGG + Intergenic
1013304476 6:108835520-108835542 GCCATGCCTCAGGTGGCTGCTGG + Intergenic
1016914652 6:149233405-149233427 GCTGGGCCCTGGGTGGCTCTGGG - Intronic
1017811945 6:157989952-157989974 GCCTTGCCCTGGGGGGCACTGGG + Intronic
1019745926 7:2700383-2700405 GCCGTCCCCCGGGTGGCCCATGG + Exonic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1023890838 7:44390962-44390984 GCCATGCCCCGGGTGGAAAAGGG + Intronic
1024046502 7:45589234-45589256 GCCAGGCCCTGGGTGGCACCAGG - Intronic
1024748380 7:52433143-52433165 GCCATGTCCCTGGTGTCCCTTGG + Intergenic
1029215357 7:98944605-98944627 GCCATGGCCCTGTTGTCTCTGGG - Intronic
1029737243 7:102471779-102471801 GCCATGGCCCAGGGGGCTGTTGG - Intronic
1029737264 7:102471840-102471862 GCCATGGCCCAGGGGGCTGTTGG - Intronic
1030114097 7:106050169-106050191 GCCAGGCCCCAGCTGGCTCATGG - Intergenic
1034421824 7:150994720-150994742 TCCCTGCCGCTGGTGGCTCTGGG + Intronic
1035637633 8:1158720-1158742 ACCAGGACCCGCGTGGCTCTGGG - Intergenic
1035945100 8:3953922-3953944 GCCCTGGCAAGGGTGGCTCTGGG + Intronic
1040661677 8:49582584-49582606 GCCCTGCCCGGGGAGTCTCTGGG - Intergenic
1049305268 8:141899503-141899525 CCCCTGCCCTGGGTGGCTCAGGG + Intergenic
1049544147 8:143221715-143221737 CCCCTGCCCCAGGTGGCTCCGGG - Intergenic
1049591081 8:143462949-143462971 GCGCTGCTCCTGGTGGCTCTAGG - Intronic
1049638903 8:143705524-143705546 GCCAGGCCCCGGGAGGTGCTGGG + Intronic
1053161403 9:35815559-35815581 GCCCCACCCCGGGTGGTTCTTGG - Intronic
1056589474 9:87954296-87954318 GCCATGGCCTGGGAGGATCTGGG - Intergenic
1056754575 9:89373709-89373731 GCCCTGCCCTGGGTGGCTGGGGG + Intronic
1057848928 9:98549592-98549614 GCCATGCCCCTGGGGGCTGGTGG + Intronic
1058885892 9:109320846-109320868 GCCCTGCTCCGGCTGGCCCTCGG - Exonic
1059899524 9:118907686-118907708 GCCATGCCCTGGGTTCCTGTTGG + Intergenic
1060033142 9:120232859-120232881 ACCCTGCCCCAGGTGGCCCTTGG + Intergenic
1060104734 9:120866530-120866552 GCCCTGCCCAGGGTTGCTGTGGG - Intronic
1061590773 9:131596241-131596263 GTCCTGCCCCGGGTGCCACTCGG - Intronic
1061704735 9:132444276-132444298 GCAATGCCGCAGGTGGCTCTAGG - Intronic
1061975585 9:134066907-134066929 TCCCTGCCCCCGGTGGGTCTCGG + Intronic
1187010948 X:15278578-15278600 GTTAAGCCCCGGGAGGCTCTAGG - Intergenic
1187230263 X:17415025-17415047 GCCCTGCCCCGGGAGGTTGTGGG + Intronic
1189188600 X:39075475-39075497 GCCCTCCCCCTGGAGGCTCTAGG - Intergenic
1194330767 X:92580871-92580893 CCCTTGCCCCGTGTGGCTCCTGG + Intronic
1200639471 Y:5699941-5699963 CCCTTGCCCCGTGTGGCTCCTGG + Intronic
1202352884 Y:24012638-24012660 GCCAGGCCCCGGGAAGTTCTGGG - Intergenic
1202517895 Y:25657477-25657499 GCCAGGCCCCGGGAAGTTCTGGG + Intergenic