ID: 1184250796

View in Genome Browser
Species Human (GRCh38)
Location 22:43259048-43259070
Sequence GCTGATGTTGTGAAACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184250796_1184250803 1 Left 1184250796 22:43259048-43259070 CCAGGATGTTTCACAACATCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1184250803 22:43259072-43259094 ACCTGGGTTGGCTGAAAAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 179
1184250796_1184250805 14 Left 1184250796 22:43259048-43259070 CCAGGATGTTTCACAACATCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1184250805 22:43259085-43259107 GAAAAGGGGGCAGAACAGAAAGG 0: 1
1: 0
2: 3
3: 57
4: 657
1184250796_1184250802 0 Left 1184250796 22:43259048-43259070 CCAGGATGTTTCACAACATCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1184250802 22:43259071-43259093 AACCTGGGTTGGCTGAAAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 135
1184250796_1184250800 -2 Left 1184250796 22:43259048-43259070 CCAGGATGTTTCACAACATCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1184250800 22:43259069-43259091 GCAACCTGGGTTGGCTGAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1184250796_1184250801 -1 Left 1184250796 22:43259048-43259070 CCAGGATGTTTCACAACATCAGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1184250801 22:43259070-43259092 CAACCTGGGTTGGCTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184250796 Original CRISPR GCTGATGTTGTGAAACATCC TGG (reversed) Intronic
902756975 1:18555495-18555517 GCTGATTTTCTGAGTCATCCAGG + Intergenic
904412388 1:30332304-30332326 GCTCATGTTGAGAAACAGCAAGG - Intergenic
905807763 1:40889226-40889248 GTTGATGTTGTGAGACCTCCGGG + Intergenic
905937504 1:41836474-41836496 GAGGACGTTCTGAAACATCCTGG - Intronic
909474863 1:76071530-76071552 GCTGATGTAGTGAAAGGGCCAGG + Intergenic
910711773 1:90189403-90189425 GTTGATGTTGACAAACAGCCAGG + Intergenic
910985999 1:93005393-93005415 GCTGATGTTCTGAAACTCTCTGG - Intergenic
913182416 1:116334952-116334974 GACCATGTGGTGAAACATCCTGG - Intergenic
913499775 1:119461570-119461592 GCTGTTGGTGTGAAACAGTCTGG - Intergenic
916871542 1:168919967-168919989 TCTGATGTTGTAAAACATATAGG + Intergenic
919350900 1:196452761-196452783 GCTGATGGTGTGAGAGACCCAGG + Intronic
923237089 1:232044939-232044961 GCGGATGATGTGAAACAGGCAGG - Intergenic
1064979412 10:21151298-21151320 ACTCATGTGGTGAAACTTCCAGG + Intronic
1065368684 10:24959928-24959950 TCTCATCTTGTGAAATATCCTGG + Intergenic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1067547274 10:47202145-47202167 GTTGATTTTGTGAAAGATCATGG + Intergenic
1070763413 10:79040616-79040638 GCTGAGCTTGTGAAACAACTTGG - Intergenic
1070992556 10:80745329-80745351 GCTGATGTGCTGAAAACTCCAGG - Intergenic
1073195588 10:101688203-101688225 GGTGATGTTTTGAAAGAGCCTGG + Intronic
1074577301 10:114682381-114682403 GCTGTTGTTTTAAAACATCCGGG + Intronic
1076495124 10:130891959-130891981 GCTGAAGTTGTGAAAGTTCAGGG + Intergenic
1077032619 11:476373-476395 GGTGATGGTGAGAAACTTCCCGG + Intronic
1083451392 11:62748059-62748081 ACTGATGTTCTGAGACAACCAGG + Intergenic
1084449887 11:69230308-69230330 GGTGATGAAGAGAAACATCCAGG - Intergenic
1090082625 11:123624219-123624241 GCTGATGTTCTGGGACATCTGGG - Intronic
1094176863 12:27549925-27549947 GCTGATGTTGCGTAACCTCCCGG + Intronic
1096475954 12:51908934-51908956 GGTGATGCAGTGGAACATCCAGG - Intronic
1098856944 12:75663761-75663783 TCTGTTGTTGTTAAACTTCCAGG + Intergenic
1099455205 12:82854679-82854701 CCTGATATAGTGAACCATCCCGG + Intronic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106720558 13:32430689-32430711 GCTGATATTGTGTTACAGCCTGG - Intergenic
1108507840 13:51128731-51128753 GCTGATGTTGTGATTCACTCAGG + Intergenic
1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG + Intronic
1114825055 14:26067166-26067188 GCTGTCCTTGTGAAACAGCCAGG + Intergenic
1114955242 14:27809345-27809367 TCTGATTTTTTGAAACAACCAGG - Intergenic
1115403230 14:32987395-32987417 GCTGATGCTTTCAAACATGCAGG - Intronic
1122701966 14:103595787-103595809 GCTGATTCTGTAAAACATTCTGG - Intronic
1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1138638584 16:58364251-58364273 ACTGCTGATGTGCAACATCCAGG - Intronic
1151729742 17:75904351-75904373 GCAGAAGGTGTGAAAAATCCTGG + Intronic
1156210125 18:34930471-34930493 GCTGAGGTTGGGAAACAAGCTGG - Intergenic
1159945919 18:74444877-74444899 GCTGATGGTGTGCAAGATACTGG + Intronic
1161539569 19:4841995-4842017 GCAGAAGTTGTAAACCATCCGGG + Intronic
1163903829 19:20133396-20133418 GGATATGTTGTCAAACATCCAGG + Intergenic
1165371449 19:35409021-35409043 GCAGAAGTTGTTGAACATCCTGG - Intergenic
1165942718 19:39423292-39423314 CCTGATGTTGGGTGACATCCTGG - Exonic
1167120294 19:47512735-47512757 CCTGGTGTGGAGAAACATCCGGG - Intronic
1168301362 19:55407100-55407122 GCTGATGGCCTGAAGCATCCTGG - Intronic
1168399512 19:56076944-56076966 GCTGAAGTGGAGAAGCATCCAGG + Intergenic
928421963 2:31144307-31144329 GATGACGATGTGAAACCTCCTGG + Intronic
930299865 2:49601886-49601908 GCAGATGTTTTGAAATATGCAGG + Intergenic
931132572 2:59353688-59353710 GCAGCTGATGTGAAACATTCTGG + Intergenic
931454438 2:62397086-62397108 GCTGCAGTTATGAAACATCAAGG - Intergenic
934482103 2:94660173-94660195 TCTGATTTTTTGAAACAACCAGG + Intergenic
935081784 2:99805170-99805192 GCTGATGTTTTGGTAAATCCAGG + Intronic
941210806 2:162636534-162636556 GCTTATGCTTTGAATCATCCAGG - Intronic
947797458 2:232903916-232903938 GCTTAAGTTGTGAAACAGGCTGG + Intronic
948159396 2:235811887-235811909 GCTGATGTTTTGAGAGAACCAGG + Intronic
1169110373 20:3029093-3029115 CCTGATGTAATGAAACATCAGGG - Intronic
1169210327 20:3762887-3762909 GCTGATGTGGTGAAAAAAACAGG - Intronic
1169499727 20:6147853-6147875 GGCGATGGTGTGAAACAGCCTGG + Intergenic
1169942808 20:10955598-10955620 GTAGCAGTTGTGAAACATCCTGG + Intergenic
1173279461 20:41615804-41615826 CCTGATGTTGTGGAACCTCATGG + Intronic
1173582055 20:44154396-44154418 GCTGTAAATGTGAAACATCCTGG - Intronic
1174106067 20:48163157-48163179 CCTGATGTTCTTAAACATCCTGG - Intergenic
1179286357 21:39980571-39980593 GCGGAGTTTGAGAAACATCCTGG + Intergenic
1184250796 22:43259048-43259070 GCTGATGTTGTGAAACATCCTGG - Intronic
949304718 3:2627099-2627121 GCTGAAGTTGGGAGACCTCCTGG + Intronic
949908775 3:8882550-8882572 GCTGATGGTGGGAAACAGCCGGG - Intronic
956176875 3:66481208-66481230 TTTGATGTTGTGTAGCATCCTGG - Intronic
956867524 3:73384391-73384413 GCCGCTGTTGTGCAGCATCCAGG + Exonic
960748895 3:120924141-120924163 GATAATGATGTGAAACATACTGG - Intronic
960985747 3:123279463-123279485 GCTGATGTTGTGAACGCTGCTGG + Intergenic
964170625 3:153766209-153766231 ACTGAAGTTGTCAAAAATCCAGG - Intergenic
966505227 3:180693132-180693154 GCTGATGTTTACAAACATACAGG - Intronic
967437468 3:189466065-189466087 GCTGATGCTGTGACAGATGCTGG - Intergenic
968307859 3:197661418-197661440 GCAGATGCTGTGGAACAGCCTGG + Intergenic
968491164 4:891397-891419 GCTGAAGTGATGGAACATCCTGG - Intronic
970726602 4:19053116-19053138 GCTGACGTTGTGATATAACCTGG + Intergenic
972827791 4:42781104-42781126 GCTGATGGTGTGAAACAGCATGG + Intergenic
974694099 4:65342168-65342190 GTTGTTGTTGTTAAACATCCAGG + Intronic
977007235 4:91583924-91583946 AATGATGTTTTGAAACATTCTGG + Intronic
984153825 4:176168788-176168810 GCTGATGATGTTAAATATTCTGG + Intronic
985937778 5:3110001-3110023 GCTGATCTTGAAAAACATTCTGG - Intergenic
986590577 5:9365204-9365226 CCTGATTTTGTTAAACAACCAGG + Intronic
987288758 5:16487961-16487983 GCTGTAGTTGTGAGACACCCAGG + Intronic
993983963 5:94574640-94574662 GCTGAGGTTGTGAAACAGCAGGG - Intronic
996712674 5:126559062-126559084 GCAGATGTTGTTAATCATTCAGG - Intronic
999041153 5:148414174-148414196 GCTGATGTGGTAGAAAATCCTGG + Exonic
1000984306 5:167850224-167850246 TGTGATATTGTGAAATATCCTGG - Intronic
1004626469 6:17381753-17381775 ACTCATGTTGTGAAGAATCCTGG + Intergenic
1008136683 6:47785420-47785442 GCTGATGGTATGAAACCACCAGG - Intronic
1010308619 6:74355288-74355310 GCTAATATTTGGAAACATCCTGG + Intergenic
1012069213 6:94590820-94590842 GCTGATGTTATGCAAAATGCTGG + Intergenic
1012977765 6:105798263-105798285 GCTGAGGTTGTGCAACTCCCTGG - Intergenic
1013090769 6:106898618-106898640 GCTGATGTTGAGAAAAATCCAGG - Intergenic
1013360495 6:109389817-109389839 TCTGATGTTGTGAAAGAACTGGG - Intergenic
1015495877 6:133882847-133882869 AGTGATGTTGTGTAACTTCCAGG + Intergenic
1016260842 6:142168387-142168409 GCTGATTTTATGAAAAATCCTGG + Intronic
1017449621 6:154542273-154542295 GCTGCTTTTGGGAAACAGCCTGG - Intergenic
1020509303 7:9032904-9032926 GCAGATGTTCTGGAACATCTTGG + Intergenic
1024427379 7:49242104-49242126 GCTGCTATGGTGAAACATTCAGG + Intergenic
1032722131 7:134558851-134558873 GCTGATGTTCTGGAAACTCCAGG - Intronic
1041626452 8:60034289-60034311 TCTGATGTTGTTAAAAATCTAGG - Intergenic
1044725349 8:95190464-95190486 GCTTGTGTTATGAAACACCCTGG + Intergenic
1046423751 8:114018685-114018707 AATGATGTTGTGTGACATCCAGG + Intergenic
1053675723 9:40424541-40424563 TCTGATTTTTTGAAACAACCAGG - Intergenic
1053925516 9:43050877-43050899 TCTGATTTTTTGAAACAACCAGG - Intergenic
1054287991 9:63200353-63200375 TCTGATTTTTTGAAACAACCAGG + Intergenic
1054386826 9:64564606-64564628 TCTGATTTTTTGAAACAACCAGG - Intergenic
1054508899 9:65951751-65951773 TCTGATTTTTTGAAACAACCAGG + Intergenic
1055572746 9:77633031-77633053 GCAAATGTTATGAAACACCCAGG + Intronic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1059397969 9:114050637-114050659 GCTGATGTTGTGAAATGTTCAGG + Exonic
1186965970 X:14786312-14786334 GATGATGCTGTGAATAATCCGGG - Intergenic
1187586128 X:20663808-20663830 GCTAATGATGTTAAACATCTTGG - Intergenic
1187617919 X:21018355-21018377 GGTGTTGTTGAGAAACAGCCAGG - Intergenic
1187755255 X:22518238-22518260 GTAGATGTTGTGAGGCATCCAGG + Intergenic
1188078385 X:25807034-25807056 GATGATCTTGTGTAATATCCAGG + Intergenic
1190175288 X:48143817-48143839 ACTCTGGTTGTGAAACATCCTGG + Intergenic
1192558599 X:72109879-72109901 GCTGGGGTTGTTAAACACCCTGG + Intergenic
1193714057 X:84916506-84916528 GCTGATCTTCTCAAAGATCCAGG - Intergenic
1198435678 X:136614808-136614830 ACTGATTTTGAGACACATCCTGG + Intergenic
1199507648 X:148584183-148584205 ACTGATGTTGAGTAAGATCCCGG - Intronic